Table 2: Primers used in this work.

Primer group and nameSequence (5′ to 3′)

Oligonucleotides for strain construction
F-leu3TGCAATTATGGAAGGAAGATCAGATTTTGTGGCGACTTCACACAGCTGAAGCTTCGTACGC
R-leu3GGACTTTAAACCTTGGGATTGAACGCAAATTCATTCATTAAACATAGGCCACTAAGTGGATCTG
F-STP1-HACAATATTTGAATTTTTACAATGACAACTTTGGGTCACAATTTCGGATCCCCGGGTTAATTAA
R-STP1-HATTCCAATATGATACCCTTATTTTTATCCCGTGTTATATTTAAGAATTCGAGCTCGTTTAAAC
F-LEU3 prom AGGTGCCGCCTAATTTATCG
R-LEU3 intACTTCTGCTGACGACATTCC
F-KanMX6 intCATCCTATGGAACTGCCTCG
R-KanMX6 intGATAGATTGTCGCACCTGATTG
F-STP1 intGCACAAGATAATCCTTCGTTCC
R-STP1 downTCGGCTTTCCAATATGATACCC
R-Kan intCTATACCTGAGAAAGCAACCTG

Oligonucleotides for RT-qPCR
F-qRT-UGA4CTGCTGCTGTCACATTAACC
R-qRT-UGA4AATACACATAACCACCACTGC
F-qRT-DAL7AACCGAACAAATCAGGAAC
R-qRT-DAL7CAAGTTGGAGATGAAGAGTC
F-qRT-BAP2TAGAGGATGGCGTTGAGTC
R-qRT-BAP2ACCAAGATGTAACCAATTATTAGC
F-qRT-AGP1ATCTTATTCCTATTCTTGGCTACC
R-qRT-AGP1CGGCGTTAATGAAGTGTGG
F-qRT-TBP1TATAACCCCAAGCGTTTTGC
R-qRT-TBP1GCCAGCTTTGAGTCATCCTC

Oligonucleotides for ChIP
F-UGA4GGAACTGATTACTGTGCCAAG
R-UGA4AATCGCTTATCGCTTATCGTG
F-AGP1TTATACCTCGGCGGCTTC
R-AGP1GCAAGATTTCTCCAAAGTCC
F-BAP2AGGAGGCTACTGACACTGC
R-BAP2GCTGACATATTTACCGTTGAAGG
F-DAL7AATCTCCGCTGAAGTTGC
R-DAL7TTTCACGATGTACCTTATCCAAGA
F-UCAGTCCAATACCTCTGTCCTC
R-UCAGCCGCAACTTCATTCTG