Journal of Diabetes Research / 2013 / Article / Tab 1

Research Article

The Hypocholesterolemic Effect of Germinated Brown Rice Involves the Upregulation of the Apolipoprotein A1 and Low-Density Lipoprotein Receptor Genes

Table 1

(a) Gene name, accession number, and primer sequences used in the GeXP multiplex analysis of rat hepatic genes. (b) Gene name, accession number, and primer sequences used in the GeXP multiplex analysis of HEPG2 genes.
(a)

Gene name
accession number *
Primer sequence  (with universal tag)
ForwardReverse

LDLR NM_175762 AGGTGACACTATAGAATAATGAAGCCATTTTCAGTGCCGTACGACTCACTATAGGGAAGGTGAACTTGGGTGAGTGG
HMGCR NM_013134 AGGTGACACTATAGAATATAGAGACGTCTGCGGTCCTTGTACGACTCACTATAGGGATTAACCCATTGGAGGTGAGC
APO A1 NM_012738 AGGTGACACTATAGAATACAACTGGGACACTCTGGGTTGTACGACTCACTATAGGGAATCTCCTTCGCGTTTTTGTG
Actb NM_031144 aAGGTGACACTATAGAATAGGCATCCTGACCCTGAAGTAGTACGACTCACTATAGGGAAGACGCAGGATGGCATGAG
GAPDH NM_017008 aAGGTGACACTATAGAATACTGAGGACCAGGTTGTCTCCGTACGACTCACTATAGGGAGAGGGCCTCTCTCTTGCTCT
PPIA NM_017101 a,*AGGTGACACTATAGAATATTCTGTAGCTCAGGAGAGCA GTACGACTCACTATAGGGATTGAAGGGGAATGAGGAAAA
KanRb

aHousekeeping gene.  bInternal control.  *Normalization gene.
(b)

Gene name   
Accession number *
Primer sequence   (with universal tag)
ForwardReverse

LDLR NM_000527 AGGTGACACTATAGAATACAGGACGGCTACAGCTACCCGTACGACTCACTATAGGGACTTATCCTTCACGAGGAAAGGA
HMGCR NM_000859 AGGTGACACTATAGAATAAATGGCAACAACAGAAGGTTGTGTACGACTCACTATAGGGAGAAACGGATATAAAGGTTGCGT
APO A1 NM_000039 AGGTGACACTATAGAATATGTGTACGTGGATGTGCTCAGTACGACTCACTATAGGGAGAGCTCCATCTCCTCCTGC
Actb NM_001101 aAGGTGACACTATAGAATAGATCATTGCTCCTCCTGAGCGTACGACTCACTATAGGGAAAAGCCATGCCAATCTCATC
GAPDH NM_002046 a,*AGGTGACACTATAGAATAAAGGTGAAGGTCGGAGTCAA GTACGACTCACTATAGGGAGATCTCGCTCCTGGAAGATG
EEF1A1 NM_001402 aAGGTGACACTATAGAATACACACGGCTCACATTGCATGTACGACTCACTATAGGGACACGAACAGCAAAGCGA
KanRb

aHousekeeping gene.   bInternal control.   *Normalization gene.