Journal of Diabetes Research / 2013 / Article / Tab 1

Research Article

Benidipine Protects Kidney through Inhibiting ROCK1 Activity and Reducing the Epithelium-Mesenchymal Transdifferentiation in Type 1 Diabetic Rats

Table 1

Primer sequences for ROCK1 and -actin.

PrimersPrimer sequencesProductDenature

Rock1Forward: AAGAGAGTGATATTGAGCAGTTGCG 192 bp 61°C
Reverse: TTCCTCTATTTGGTACAGAAAGCCA

β-Actin Forward: AAGATGACCCAGATCATGTTTGAG 146 bp60°C
Reverse: TAGATGGGCACAGTGTGGGTG

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.