Research Article
The Effect of Dantonic Pill on β-Catenin Expression in a Rat Model of Streptozotocin-Induced Early Stage of Diabetic Nephropathy
Table 1
Nucleotide sequence of the primers used in real-time PCR.
| Gene | Primers | Nucleotide sequence 5′-3′ | Length (bp) | Temperature (°C) |
| -catenin | Forward | AACGGCTTTCGGTTGAGCTG | 118 | 60 | Reverse | TGGCGATATCCAAGGGCTTC | -actin | Forward | TGCCTTTGTGCACTGGTATG | 152 | 60 | Reverse | CTGGAGCAGTTTGACGACAC |
|
|