The Orphan Nuclear Receptor 4A1: A Potential New Therapeutic Target for Metabolic Diseases

Zhang, Lei; Wang, Qun; Liu, Wen; Liu, Fangyan; Ji, Ailing; Li, Yanzhang

doi:https://doi.org/10.1155/2018/9363461

Journal of Diabetes Research

On this page

Abstract Introduction Conclusions Conflicts of Interest Acknowledgments References Copyright Related Articles

Review Article | Open Access

Volume 2018 | Article ID 9363461 | https://doi.org/10.1155/2018/9363461

The Orphan Nuclear Receptor 4A1: A Potential New Therapeutic Target for Metabolic Diseases

Lei Zhang,¹Qun Wang,¹Wen Liu,¹Fangyan Liu,¹Ailing Ji,¹and Yanzhang Li¹

Academic Editor: Steven F. Abcouwer

Received20 Nov 2017

Revised12 Mar 2018

Accepted20 Mar 2018

Published14 Jun 2018

Abstract

Orphan nuclear receptor 4A1 (NR4A1) is a transcriptional factor of the nuclear orphan receptor (NR4A) superfamily that has sparked interest across different research fields in recent years. Several studies have demonstrated that ligand-independent NR4A1 is an immediate-early response gene and the protein product is rapidly induced by a variety of stimuli. Hyperfunction or dysfunction of NR4A1 is implicated in various metabolic processes, including carbohydrate metabolism, lipid metabolism, and energy balance, in major metabolic tissues, such as liver, skeletal muscle, pancreatic tissues, and adipose tissues. No endogenous ligands for NR4A1 have been identified, but numerous compounds that bind and activate or inactivate nuclear NR4A1 or induce cytoplasmic localization of NR4A1 have been identified. This review summarizes recent advances in our understanding of the molecular biology and physiological functions of NR4A1. And we focus on the physiological functions of NR4A1 receptor to the development of the metabolic diseases, with a special focus on the impact on carbohydrate and lipid metabolism in skeletal muscle, liver, adipose tissue, and islet.

1. Introduction

The nuclear receptor superfamily includes at least 48 members of transcription factors that regulate multiple cellular and metabolic functions in diverse bioprocesses [1]. The NR4A family is an orphan nuclear receptor because the endogenous ligands of these receptors are not identified [2]. The NR4A protein subclass contains three highly homologous members named Nur77/NR4A1 (human homologue TR3, mouse homologue Nur77, and rat homologue NGFI-B), Nurr1/NR4A2, and Nor1/NR4A3 [3, 4]. These three NR4A receptors exhibit a high degree of homology in genomic structure [5], an N-terminal region that contains a ligand-independent activation function-1 (AF-1), also known as the transactivation domain (TAD), which is required for the coactivator recruitment and transcriptional activity [6], a conserved central DNA-binding domain (DBD) composed of 2 zinc fingers that recognize specific DNA sequences, a hinge region, and a ligand-binding domain (LBD) that contains a ligand-dependent AF-2 transactivation domain in the C-terminal region [7, 8]. The AF-1 domain is necessary for the recruitment of other transcription factors and transcriptional activity in the N-terminal region [6]. The transcriptional activation activity of NR4A receptors is exerted as monomers at specific DNA sequences known as NGFI-B response element (NBRE), which consist of an octanucleotide (AAAGGTCA) motif [9–11]. NR4A receptors also bind as homodimers or heterodimers to a Nur-responsive element (NuRE:TGATATTACCTCCAAATGCCA) which has been characterized from the proopiomelanocortin gene promoter [11]. In addition, both NR4A1 and NR4A2 are able to bind as heterodimers with the 9-cis RAR to an imperfect direct repeat (DR) sequence separated by five nucleotides (DR-5: GGTTCACCGAAAGGTCA) [12, 13]. The LBD structure of the NR4A1 seems clear, but its ligand binding and regulation activity are controversial. The LBDs recognize small molecule ligands to induce the characteristic responses. Heptad repeats of hydrophobic amino acids in LBD are involved in nuclear receptor dimerization and may regulate target nuclear localization [6]. However, structural studies on the LBD of the three NR4A members reveal that the hydrophilic surfaces, instead of the classic hydrophobic cleft that recruits the coactivator, are contained in the LBD of the NR4A receptor [14]. Therefore, no appropriate ligand-binding cavity is used to bind small molecular ligands and regulate the physiological function of NR4A. These observations suggest that the regulation activity of NR4A receptors is ligand independent and the function of NR4A is dependent on receptor expression and posttranslational modification [15]. However, several ligands that may interact with these receptors are identified recently [16–18]. Therefore, it is not clear whether NR4A is still a ligand-independent orphan nuclear receptor. More experimental data are required to provide a more appropriate answer.

NR4A1 is the most deeply research member of the NR4A family, and there is an overlapping and compensatory biological function between NR4A1 and the other two members from the NR4A family because of the structural homology. NR4A1 is an early response gene with pleotropic functions that are rapidly and transiently induced by a diverse range of signals, including stressors [19], growth factors, cytokines [20], the proanorexic melanocortin α-MSH [21, 22], glucose, fatty acids [4], lipopolysaccharides [23], exercise [24], and many small molecular compounds. Many physiological and pathological processes are related to NR4A1 expression, such as glucose and lipid metabolism, insulin synthesis, vascular disease, inflammation, immunity, and carcinogenesis control [25–27]. NR4A1 is associated with various hormonal, physiological, and pathophysiological diseases in humans, including metabolic disease [28, 29], cardiovascular disease [30], apoptosis [31], neurodegenerative diseases [32], steroidogenesis [30, 33], inflammation [34, 35], and oncogenesis [36]. This review summarizes recent progress in our understanding of the physiological and pathophysiological functions of NR4A1 receptors and discusses the role of these receptors as transcriptional regulators of gene expression in glucose and lipid metabolism.

2. Diverse Stimuli and Signals Induce NR4A1 Expression

NR4A1 is an immediate-early response gene that is induced by a diverse variety of signals in a wide range of tissues and cultured cells. Physiological stressors also induce NR4A1 expression and activation. Fasting induces hepatic NR4A1, which may bind to the putative NBRE of the fibroblast growth factor-21 (FGF21) promoter and regulate FGF21 expression, which plays pivotal roles in the treatment of metabolic syndromes [37]. A 17-fold increase of NR4A1 is observed in cardiomyocytes during acute ischemia/reperfusion (I/R) in dog, and the overexpression of NR4A1 significantly increases proteins translocated to the mitochondria. Therefore, NR4A1 may be involved in I/R-induced cell death and mitochondrial damage [38–40]. The following stimuli also induce NR4A1 in different cells: drugs of abuse, stress in nuclei of the motivation/reward circuit of the brain [41], membrane depolarization in PC12 pheochromocytoma cell line [42], mechanical agitation in several leukemic cell lines in a stimulus-dependent manner [43], acute hypotensive hemorrhage, intravenous injection of interleukin-1 beta, chronic salt loading, and acute bilateral adrenalectomy in similar neuroendocrine cell types [44].

NR4A1 is an orphan nuclear receptor, and no traditional ligand-binding cavity is used to bind small molecular ligands and regulate the physiological functions of NR4A1. No endogenous ligands have been previously identified for NR4A1. However, several synthetic and natural compounds that may interact with NR4A1 in unconventional ways are identified as agonists or antagonists. Cytosporone B (Csn-B) is the first naturally occurring agonist for nuclear orphan receptor NR4A1. Csn-B binds with high affinity (IC50 = 0.278 nM) to the ligand-binding domain of NR4A1 and stimulates NR4A1-dependent activities [45, 46]. Indeed, Csn-B physically binds to NR4A1 resulting in an increased expression and stimulation of its transcriptional activity in vivo [47]. The first NR4A1 agonist, 6-mercaptopurine, is obtained through high-throughput screening, and it inhibits tumor necrosis factor-α production in microglia via NR4A1-mediated transrepression and PI3K/Akt/mTOR signaling-mediated posttranslational modification. This agonist may be a good candidate for the effective treatment of nerve inflammation-related neurodegenerative diseases [27, 35]. Celastrol is another NR4A1 agonist that alleviates inflammation and induces autophagy in a NR4A1 dependent via interaction with TRAF2 in primary embryonic fibroblasts and C57 mice [48]. The following small molecular compounds also directly regulate NR4A1 activity in different cells: 1,1-bis(3-indolyl)-1-(p-hydroxyphenyl)methane (DIM-C-pPhOH) and the related p-carboxymethylphenyl (1,1-bis(3-indolyl)-1-(p-carboxymethylphenyl)methane (DIM-C-pPhCO2 Me)) analogs, which bind NR4A1 to inhibit growth and induce apoptosis in several cancer cell lines and tumors from mouse xenografts [49, 50]. Amoitone B is also a natural agonist to NR4A1, and it exhibits strong antitumor activity in vivo and in vitro [51].

Small molecular compounds also modulate NR4A1 activity by influencing the upstream signaling pathway of NR4A1. Retinoic acids induce NR4A1 expression and apoptosis, which is completely dependent on NR4A1 in mouse thymocytes [52]. The pronounced increase in NR4A1 expression by palmitate and oleate plays a pivotal role in the adaptive process of hyperlipidemia in beta-cells (INS cells) [53]. The following small molecule compounds also regulate NR4A1 activity: the β-adrenergic agonist isoproterenol in cardiomyocytes [54–56], trichostatin A (TSA) in PC12 cells [57], glucagon and forskolin in vivo and in vitro [58], norcantharidin (NCTD) in melanoma cells [59], phorbol ester (TPA) in granulosa cells [60], and thiazolidinedione drugs in 3T3-L1 adipocytes [61].

The orphan nuclear receptor NR4A1 regulates diverse cellular activities, and the nature of these biological functions is dependent on NR4A1 expression levels and the physiological context. Numerous growth promoter signals, such as insulin-like growth factor binding protein-3 (IGFBP-3), nerve growth factor (NGF), epidermal growth factor (EGF), and vascular endothelial growth factor (VEGF), induce NR4A1 expression. The elevated expression of NR4A1 induced by the β-cell transcription factor Nkx6.1 promotes islet β-cell proliferation and plays an important role in the functional restoration of these cells [62–64]. NR4A1 mRNA and protein expression induced by platelet-derived growth factor (PDGF) via ERK-MAPK-dependent signaling pathways is involved in the regulation of vascular smooth muscle cell proliferation [65]. The following growth promoter signals are also relevant for NR4A1 activity: IGFBP-3 in chondrocytes [66], vascular endothelial growth factor-A (VEGF-A) in endothelial cells [67], NGF in PC12 cells, and EGF in PC12 cells [68].

NR4A1 plays a critical role in numerous cellular processes in response to inflammatory-related cytokines, such as lipopolysaccharide (LPS), TNFα, IL-1, and oxidized lipids [69, 70]. Recent interest has been focused on the potent anti-inflammatory effect of NR4A1 in inflammatory diseases [71, 72]. Genetic studies revealed a critical role of NR4A1 in the control of inflammatory responses, which is highlighted by its protective function in atherosclerosis and obesity [48].

The role of microRNAs (miRNAs) is a far-reaching discovery in cancer in the past decade. miRNAs act as negative regulators of gene expression via combining to the 3 untranslated region (3 UTR) of a target mRNA to destabilize it or inhibit its translation [36]. miR-124 targets NR4A1 and decreases its expression and function, which attenuates cell proliferation in DAOY medulloblastoma cells [36].

3. NR4A1 Receptor in Carbohydrate Metabolism

Glycogen synthesis, decomposition, and gluconeogenesis in the liver play pivotal roles in the regulation of glucose homeostasis. The dysregulation of these processes may contribute to the pathogenesis of several diseases, including diabetes mellitus, obesity, and hepatic steatosis. The expression of NR4A1 is closely related to gluconeogenesis. NR4A1 is highly expressed in type 1 diabetes mellitus (T1DM) and type 2 diabetes mellitus (T2DM) mouse models, and the ablation of liver NR4A1 in T2DM db/db mice via adenoviral delivery of a dominant-negative NR4A1 inhibits the expression of key enzymes of gluconeogenesis in the liver and restores elevated glucose levels to near normal [73, 74]. NR4A1 binds and sequesters liver kinase B1 (LKB1) in the nucleus and prevents LKB1 translocation from the nucleus to the cytosol to phosphorylate adenosine 5-monophosphate- (AMP-) activated protein kinase α (AMPKα), which regulates the expression of key enzymes of liver gluconeogenesis, such as glucose-6-phosphatase catalytic subunit (G6pc) and phosphoenolpyruvate carboxykinase (Pepck), and blood sugar levels [18]. These data demonstrate that NR4A1-mediated gluconeogenesis plays an important role in the manifestation of diabetic hyperglycemia. Moreover, NR4A1 suppresses hepatocellular carcinoma via switching glucose metabolism toward gluconeogenesis through attenuating Pepck sumoylation [75]. Conversely, reduced NR4A1 receptor expression markedly decreases hepatic glucose production and lowers blood glucose levels [74]. Hepatic glucose production and liver insulin resistance are reduced significantly, and systemic glucose metabolism is altered in mice lacking NR4A1 fed a high-fat diet [27, 76]. The NR4A1 agonist Csn-B increases hepatic glucose production and blood glucose levels in fasting mice [16]. In addition, berberine, an oral antidiabetic drug, has been shown to activate adenosine 5-monophosphate- (AMP-) activated protein kinase (AMPK) and increase hepatic FGF21 expression via NR4A1. Therefore, FGF21 may be a target gene of NR4A1 and exhibit multiple beneficial effects on energy metabolism [77, 78]. Figure 1 provides a schematic overview of the impact of NR4A1 on carbohydrate metabolism in the liver.

Carbohydrate is primarily stored in the form of glycogen in skeletal muscle. Most glycogen is deposited and stored in human skeletal muscle, which accounts for 70–80% of total glycogen. The liver stores the remaining portion of glycogen, which accounts for 20% of total glycogen. Another negligible but physiologically significant portion of glycogen is stored in the cardiac muscle and brain [79]. Skeletal muscle plays an irreplaceable role in the preservation of blood sugar and the regulation of blood glucose levels. The NR4A1 receptor is closely related to skeletal muscle glucose metabolic processes, including glucose uptake, glucose oxidation, glycogen synthesis, and skeletal muscle growth. And numerous stimuli, such as insulin, exercise, and beta-adrenergic signals, induce NR4A1 expression in skeletal muscle [80–82]. Beta-adrenergic signaling regulates glucose metabolism in skeletal muscle, and beta-adrenergic agonists, such as isoprenaline [83] and Csn-B, exquisitely mediate NR4A1 expression [16]. Therefore, the NR4A1 receptor is a potential mediator of skeletal muscle glucose metabolism via beta-adrenergic signaling. A NR4A1-coding adenovirus is used to infect L6 rat skeletal muscle myotubes and overexpress NR4A1 in skeletal muscle of chow-fed and fat-fed rats to examine the contribution of the NR4A1 receptor to skeletal muscle basal glucose uptake. This overexpression significantly increases basal glucose uptake and promotes the expression of genes associated with glucose uptake, such as glucose transporter 4 (GLUT4) and glycogenin [80]. These data provide compelling evidence that NR4A1 is a functional regulator of glucose uptake in skeletal muscle. NR4A1 in skeletal muscle also regulates genes involved in glycogen synthesis. Transgenic overexpression of NR4A1 remarkably increases glucose oxidation and glycogen synthesis and enhances glycogen synthase, hexokinase, and phosphofructokinase activity in L6 skeletal muscle cells and the skeletal muscle of chow- and fat-fed rats [79, 80]. NR4A1 is also closely related to glucose utilization under specific stimulation, including insulin [76, 84], endurance exercise [24, 85], and local electrical stimulation [24]. High-fat diet (60% calories from fat) fed mice with genetic deletion of NR4A1 exhibit increased susceptibility to diet-induced obesity and insulin resistance [76]. Conversely, insulin could upregulate NR4A1 expression significantly in cultured L6 skeletal muscle cells. However, the upregulated NR4A1 is localized in the nucleus and is not translocated to the cytoplasm [86]. Endurance exercise also upregulates NR4A1 receptor expression. A recent study demonstrates that regular physical exercise upregulates NR4A1 and related glucose metabolic gene expression in skeletal muscle [85]. Rats are performed acute 3 h low-intensity swimming or 3 h low-intensity treadmill running to investigate the role of local contractile activity on NR4A1 receptor expression in skeletal muscle during exercise. The results demonstrate that low-intensity swimming and treadmill running increase NR4A1 expression in muscle. Conversely, acute 1 h local electrical stimulation to the motor nerves of resting rats upregulates NR4A1 expression in skeletal muscle. These results suggest that local muscle contractile activity is required to increase NR4A1 expressions during exercise [24]. The expression of NR4A1 in skeletal muscle significantly enhances mitochondrial function in type 2 diabetes [33]. NR4A1 expression also promotes myocyte proliferation and skeletal muscle growth. Genetic knockout of NR4A1 impairs muscle growth during developmental myogenesis and muscle regeneration in mice [33, 81]. These results demonstrate that NR4A1 is a potential mediator of neuromuscular signaling in controlling glucose metabolic gene expression. Figure 1 provides a schematic overview of the impact of NR4A1 on carbohydrate metabolism in skeletal muscle.

Insulin and glucagon secreted from the islets of Langerhans regulate blood sugar balance, and the malfunction will lead to various diseases, such as type 2 diabetes, which is influenced by genetic backgrounds and environmental factors [4]. NR4A1 can be induced by glucose [87] and saturated fatty acids (SFA) in pancreatic β-cells and regulates cell proliferation and insulin secretion [4, 88]. Therefore, the NR4A1 receptor is also a lipotoxicity sensor. Pancreatic β-cells are exposed to high concentrations of palmitate [4] or glucose to investigate the effect of glucose and saturated fatty acids on insulin secretion [87]. The results demonstrate that palmitate and glucose upregulated NR4A1 expression and insulin secretion [53]. These results have implications for the link between NR4A1 expression and insulin secretion in pancreatic β-cells. Moreover, knockdown of NR4A1 and NR4A3 impedes the production of ATP and ultimately inhibits glucose-stimulated insulin secretion. In addition, NR4A1 and NR4A3 are critical for β-cell mitochondrial function and insulin secretion [89]. NR4A1 induces Nkx6.1 and Cdk5r1 expression, which mediate β-cell proliferation, and promotes β-cell mass to reverse this hallmark of T1DM and T2DM [62–64]. NR4A1 promoter is hypermethylated in patients with T2DM and in a mouse model of T2DM. T2DM model mice treated with the DNA methyltransferase 1 inhibitor aurintricarboxylic acid (ATA) show reduced activation of DNA methyltransferase 1 in pancreatic β-cells and increased expression of NR4A1 and decreased blood glucose [90]. In summary, NR4A1 expression plays an important role in the adaptive process of beta-cells to hyperglycemia. Figure 1 provides a schematic overview of the impact of NR4A1 on carbohydrate metabolism in islets.

4. NR4A1 Receptor in Lipid Metabolism

The NR4A1 receptor is also involved in lipid metabolism in the liver. The abnormal expression of NR4A1 in the liver is implicated in numerous pathophysiological processes, including fat metabolism, cholesterol metabolism, and hepatic steatosis. Hepatic NR4A1 overexpressing mice are generated using adenoviral vectors, and modulation of the plasma lipid profile is established, such as cluster of differentiation 36 (CD36) and stearoyl-coA desaturase-1 (SCD-1), to examine the contribution of the NR4A1 receptor to hepatic lipid metabolism [91, 92]. The results demonstrate that NR4A1 overexpression attenuates the production of hepatic triglycerides and regulates a variety of key genes involved in lipid metabolism. NR4A1 inhibits sterol regulatory element-binding protein 1c (SREBP1c) expression, which further reduces target gene expression, including SCD-1, mitochondrial glycerol-3-phosphate acyltransferase (GPAT), fatty acid synthase (FAS), and the LDL receptor [92]. NR4A1 modulates hepatic lipid metabolism via suppression of SREBP1c activity. The liver is an important organ in the balance of cholesterol metabolism, and NR4A1 is implicated in hepatic cholesterol metabolism. Zhang et al. use siRNA to attenuate NR4A1 and transfection of the recombinant plasmid to increase NR4A1 in HepG2 cells to investigate the underlying mechanism. NR4A1 regulates hepatic cholesterol metabolism via suppression of low-density lipoprotein receptor (LDLR) and 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCR) expression [93]. However, high cholesterol levels upregulate NR4A1 expression [94]. Hepatic steatosis and the expression of lipogenic genes increase significantly in NR4A1 null mice fed a high-fat diet [76]. In summary, NR4A1 plays an important role in the regulation of liver fat content and lipid metabolism. Figure 2 provides a schematic overview of the impact of NR4A1 on lipid metabolism in the liver.

The NR4A1 receptor is also involved in lipid metabolism in muscle. NR4A1 plays an important metabolic role in modulating lipolysis in muscle. Attenuation of NR4A1 expression by siRNAs in C2C12 skeletal muscle cells decreases lipolysis and the expression of key genes and proteins involved in the regulation of energy expenditure and lipid homeostasis, including adenosine 5-monophosphate- (AMP-) activated protein kinase gamma 3 (AMPKγ3), uncoupling protein 3 (UCP3), CD36, adiponectin receptor 2, GLUT4, and caveolin-3 [56]. Female NR4A1-deficient mice fed a high-fat diet exhibit higher weights and fat mass compared to wild-type mice fed a high-fat diet [95]. Mitochondrial dysfunction is an important hallmark of the pathogenesis of T2DM, and oxidative metabolism and mitochondrial activity are increased in NR4A1-overexpressing transgenic muscle mice [33]. Notably, NR4A1 expression in the muscle of obese men is significantly lower than that of lean men, and the expression is closely correlated with body-fat content and insulin sensitivity [80]. Therefore, low NR4A1 expression impairs lipolysis and causes fat accumulation which results in obesity. Impaired glucose and lipid metabolism are observed in the skeletal muscle of low capacity rats, and exercise training reversed this situation, which improves glucose and lipid metabolism and increases the expression of NR4A1 and target genes, including β2 adrenergic receptor (β2-AR), GLUT4, UCP3, and FAT/CD36, in skeletal muscle [96, 97]. Figure 2 provides a schematic overview of the impact of NR4A1 on lipid metabolism in muscle.

NR4A1 also plays an important metabolic role in the modulation of lipid metabolism in adipose tissue. Adipose tissue is essential in the regulation of body weight, and NR4A1 is implicated in the regulation of fat content. Higher weight and fat mass are observed in NR4A1-deficient mice fed a high-fat diet compared to wild-type mice, which supports the function of NR4A1 in mediating lipolysis and energy expenditure. NR4A1 expression is significantly decreased in mouse models of obesity and diabetes [84]. β-Adrenergic stimulation and fasting induce NR4A1 expression in white adipose tissue, and β-adrenergic stimulation also induces the expression of peroxisome proliferator-activated receptor gamma 2 (PPARγ2). The expression of several known PPARγ2 targets is also found among NR4A1-regulated genes, such as G0/G1 switch 2 (G0s2), fatty acid-binding protein 4 (Fabp4), and adiponectin (Adipoq). These results suggest an overlapping biological function between NR4A1 and PPARγ2 [20]. The PPARγ2 promoter is a direct target of NR4A1-dependent repressive regulation, and the N-terminal domain of NR4A1 is required for this regulation [20]. Brown adipose tissue shares a common developmental ancestry with skeletal muscle, and it is a specialized fat tissue that is dedicated to nonshivering thermogenesis, which is regulated by adrenoceptor antagonists and cold exposure [98, 99]. Adrenoceptor antagonist and cold exposure have upregulated NR4A1 expression in brown adipose tissue. Therefore, NR4A1 is implicated in the nonshivering thermogenesis of brown adipose tissue [100]. A dominant-negative mutant NR4A1 receptor that prevented the transcriptional activity of all NR4A receptors is transfected to brown preadipocytes in vitro to investigate the contribution of NR4A1 to nonshivering thermogenesis in brown adipose tissue [101]. Attenuation of NR4A receptor activity inhibited beta-adrenoceptor receptor-stimulated uncoupling protein 1 (UCP1) gene transcription in vitro [88]. UCP1 was identified as a direct target of Nor-1 in gel shift, chromatin immunoprecipitation, and luciferase-reporter assay promoter analyses in brown adipose tissue [101]. NR4A1 is implicated in adipogenesis, and treatment of 3T3-L1 preadipocytes with an adipogenic cocktail rapidly upregulates NR4A1 [72]. However, NR4A1 induction is not an obligatory feature of preadipocyte adipogenesis because the adipogenesis of 3T3-L1 or 3T3-F442A preadipocytes is inhibited by the retroviral transduction of NR4A1 [72]. To investigate the contribution of NR4A1 to adipogenesis, NR4A1 is overexpressed and repressed in 3T3-L1 preadipocytes. Chronic overexpression and chronic repression of NR4A1 inhibit adipogenesis, whereas transient overexpression of NR4A1 significantly promoted adipogenesis [102]. These data suggest that only a transient induction of NR4A1 may be required for adipogenesis in 3T3-L1 preadipocytes. Figure 2 provides a schematic overview of the impact of NR4A1 on lipid metabolism in adipose tissue.

In addition, the NR4A receptors have been associated to a wide range of pathological conditions, such as cancer, inflammation, neurological or cardiovascular diseases, and immune alterations. For cancer cells, NR4A1 acts as a survival factor in the nucleus, but it transforms into a killer when immigrated to mitochondria [103, 104]. In the mitochondria, NR4A1 can interact with B-cell lymphoma-2 (Bcl-2, antiapoptotic protein) and lead to the conversion of Bcl-2 from a protector to a killer which triggers the release of cytochrome c and apoptosis [51]. For inflammation, the NR4A receptors are involved in a negative feedback mechanism to maintain the inflammatory balance [105, 106]. In neurological diseases, the NR4A receptors have been involved in relevant neuronal functions and mediate cAMP-response element-binding protein- (CREB-) dependent neuroprotection [107]. In cardiovascular diseases, the NR4A receptors are induced by a wide range of stimuli in vascular cells and have been found to induce atherosclerosis lesions in human subjects and experimental models [108]. In immune response, NR4A1 also takes part in the development and maturation of monocytes [109, 110].

5. Conclusions

In summary, orphan nuclear receptor NR4A1 is an immediate-early response gene that is rapidly induced by a variety of stimuli, including multiple stress reaction compounds, growth promoters, cytokines, and miRNA. Increasing evidence implicates NR4A1 activity in the transcription of genes involved in glucose homeostasis, lipid metabolism, and energy balance. Structural studies on the LBDs of NR4A1 revealed that no appropriate ligand-binding cavity is used to bind compound ligands and regulate the physiological and regulatory activities of NR4A. However, several recent studies have identified structurally diverse compounds that bind and activate or inactivate nuclear NR4A1. These compounds show some promise for the treatment of glucose and lipid metabolism diseases. Future studies should clarify the exact role of NR4A1 receptor in metabolism diseases, including obesity, dyslipidemia, and cardiovascular disease, and obtain more novel and effective small molecular compounds based on the structural of NR4A1.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Acknowledgments

This work was supported by the Natural Science Foundation of the Education Department of Henan Province under Grant 14A310021 and the Foundation of Science and Technology Department of Henan Province under Grants 162300410036 and 162300410233.

References

A. Chawla, J. J. Repa, R. M. Evans, and D. J. Mangelsdorf, “Nuclear receptors and lipid physiology: opening the X-files,” Science, vol. 294, no. 5548, pp. 1866–1870, 2001.
View at: Publisher Site | Google Scholar
S. A. Kliewer, J. M. Lehmann, and T. M. Willson, “Orphan nuclear receptors: shifting endocrinology into reverse,” Science, vol. 284, no. 5415, pp. 757–760, 1999.
View at: Publisher Site | Google Scholar
M. A. Maxwell and G. E. Muscat, “The NR4A subgroup: immediate early response genes with pleiotropic physiological roles,” Nuclear Receptor Signaling, vol. 4, 2006.
View at: Publisher Site | Google Scholar
C. Mazuy, M. Ploton, J. Eeckhoute et al., “Palmitate increases Nur77 expression by modula0074ing ZBP89 and Sp1 binding to the Nur77 proximal promoter in pancreatic β-cells,” FEBS Letters, vol. 587, no. 23, pp. 3883–3890, 2013.
View at: Publisher Site | Google Scholar
O. Saucedo-Cardenas, R. Kardon, T. R. Ediger, J. P. Lydon, and O. M. Conneely, “Cloning and structural organization of the gene encoding the murine nuclear receptor transcription factor, NURR1,” Gene, vol. 187, no. 1, pp. 135–139, 1997.
View at: Publisher Site | Google Scholar
J. Martinezgonzalez and L. Badimon, “The NR4A subfamily of nuclear receptors: new early genes regulated by growth factors in vascular cells,” Cardiovascular Research, vol. 65, no. 3, pp. 609–618, 2005.
View at: Publisher Site | Google Scholar
T. Okabe, R. Takayanagi, K. Imasaki, M. Haji, H. Nawata, and T. Watanabe, “cDNA cloning of a NGFI-B/nur77-related transcription factor from an apoptotic human T cell line,” Journal of Immunology, vol. 154, no. 8, pp. 3871–3879, 1995.
View at: Google Scholar
G. Niu, L. Lu, J. Gan, D. Zhang, J. Liu, and G. Huang, “Dual roles of orphan nuclear receptor TR3/Nur77/NGFI-B in mediating cell survival and apoptosis,” International Review of Cell and Molecular Biology, vol. 313, pp. 219–258, 2014.
View at: Publisher Site | Google Scholar
T. Wilson, T. Fahrner, M. Johnston, and J. Milbrandt, “Identification of the DNA binding site for NGFI-B by genetic selection in yeast,” Science, vol. 252, no. 5010, pp. 1296–1300, 1991.
View at: Publisher Site | Google Scholar
T. E. Wilson, K. A. Padgett, M. Johnston, and J. Milbrandt, “A genetic method for defining DNA-binding domains: application to the nuclear receptor NGFI-B,” Proceedings of the National Academy of Sciences, vol. 90, no. 19, pp. 9186–9190, 1993.
View at: Publisher Site | Google Scholar
A. Philips, S. Lesage, R. Gingras et al., “Novel dimeric Nur77 signaling mechanism in endocrine and lymphoid cells,” Molecular and Cellular Biology, vol. 17, no. 10, pp. 5946–5951, 1997.
View at: Publisher Site | Google Scholar
R. H. Zetterström, L. Solomin, T. Mitsiadis, L. Olson, and T. Perlmann, “Retinoid X receptor heterodimerization and developmental expression distinguish the orphan nuclear receptors NGFI-B, Nurr1, and Nor1,” Molecular Endocrinology, vol. 10, no. 12, pp. 1656–1666, 1996.
View at: Publisher Site | Google Scholar
T. Perlmann and L. Jansson, “A novel pathway for vitamin A signaling mediated by RXR heterodimerization with NGFI-B and NURR1,” Genes & Development, vol. 9, no. 7, pp. 769–782, 1995.
View at: Publisher Site | Google Scholar
K. D. Wansa, J. M. Harris, and G. E. Muscat, “The activation function-1 domain of Nur77/NR4A1 mediates trans-activation, cell specificity, and coactivator recruitment,” The Journal of Biological Chemistry, vol. 277, no. 36, pp. 33001–33011, 2002.
View at: Publisher Site | Google Scholar
Z. Wang, G. Benoit, J. Liu et al., “Structure and function of Nurr1 identifies a class of ligand-independent nuclear receptors,” Nature, vol. 423, no. 6939, pp. 555–560, 2003.
View at: Publisher Site | Google Scholar
Y. Zhan, X. Du, H. Chen et al., “Cytosporone B is an agonist for nuclear orphan receptor Nur77,” Nature Chemical Biology, vol. 4, no. 9, pp. 548–556, 2008.
View at: Publisher Site | Google Scholar
S. Chintharlapalli, R. Burghardt, S. Papineni, S. Ramaiah, K. Yoon, and S. Safe, “Activation of Nur77 by selected 1,1-bis(3-indolyl)-1-(p-substituted phenyl)methanes induces apoptosis through nuclear pathways,” The Journal of Biological Chemistry, vol. 280, no. 26, pp. 24903–24914, 2005.
View at: Publisher Site | Google Scholar
Y. Y. Zhan, Y. Chen, Q. Zhang et al., “The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK,” Nature Chemical Biology, vol. 8, no. 11, pp. 897–904, 2012.
View at: Publisher Site | Google Scholar
J. C. Helbling, A. M. Minni, V. Pallet, and M. P. Moisan, “Stress and glucocorticoid regulation of NR4A genes in mice,” Journal of Neuroscience Research, vol. 92, no. 7, pp. 825–834, 2014.
View at: Publisher Site | Google Scholar
K. Duszka, J. G. Bogner-Strauss, H. Hackl et al., “Nr4a1 is required for fasting-induced down-regulation of Pparγ2in white adipose tissue,” Molecular Endocrinology, vol. 27, no. 1, pp. 135–149, 2013.
View at: Publisher Site | Google Scholar
A. G. Smith, N. Luk, R. A. Newton, D. W. Roberts, R. A. Sturm, and G. E. O. Muscat, “Melanocortin-1 receptor signaling markedly induces the expression of the NR4A nuclear receptor subgroup in melanocytic cells,” The Journal of Biological Chemistry, vol. 283, no. 18, pp. 12564–12570, 2008.
View at: Publisher Site | Google Scholar
S.-C. M. Wang, S. A. Myers, N. A. Eriksson, R. L. Fitzsimmons, and G. E. O. Muscat, “Nr4a1 siRNA expression attenuates α-MSH regulated gene expression in 3T3-L1 adipocytes,” Molecular Endocrinology, vol. 25, no. 2, pp. 291–306, 2011.
View at: Publisher Site | Google Scholar
L. Pei, A. Castrillo, and P. Tontonoz, “Regulation of macrophage inflammatory gene expression by the orphan nuclear receptor Nur77,” Molecular Endocrinology, vol. 20, no. 4, pp. 786–794, 2006.
View at: Publisher Site | Google Scholar
E. Kawasaki, F. Hokari, M. Sasaki, A. Sakai, K. Koshinaka, and K. Kawanaka, “Role of local muscle contractile activity in the exercise-induced increase in NR4A receptor mRNA expression,” Journal of Applied Physiology, vol. 106, no. 6, pp. 1826–1831, 2009.
View at: Publisher Site | Google Scholar
J. P. McMorrow and E. P. Murphy, “Inflammation: a role for NR4A orphan nuclear receptors?” Biochemical Society Transactions, vol. 39, no. 2, pp. 688–693, 2011.
View at: Publisher Site | Google Scholar
Y. Zhao, D. A. Howatt, F. Gizard et al., “Deficiency of the NR4A orphan nuclear receptor NOR1 decreases monocyte adhesion and atherosclerosis,” Circulation Research, vol. 107, no. 4, pp. 501–511, 2010.
View at: Publisher Site | Google Scholar
M. A. Pearen and G. E. O. Muscat, “Minireview: nuclear hormone receptor 4A signaling: implications for metabolic disease,” Molecular Endocrinology, vol. 24, no. 10, pp. 1891–1903, 2010.
View at: Publisher Site | Google Scholar
X. Li, M. Xu, F. Wang et al., “Interaction of ApoA-IV with NR4A1 and NR1D1 represses G6Pase and PEPCK transcription: nuclear receptor-mediated downregulation of hepatic gluconeogenesis in mice and a human hepatocyte cell line,” PLoS One, vol. 10, no. 11, article e0142098, 2015.
View at: Publisher Site | Google Scholar
Y. Chen, R. Wu, H. Z. Chen et al., “Enhancement of hypothalamic STAT3 acetylation by nuclear receptor Nur77 dictates leptin sensitivity,” Diabetes, vol. 64, no. 6, pp. 2069–2081, 2015.
View at: Publisher Site | Google Scholar
A. Daugherty, “Atherosclerosis: cell biology and lipoproteins,” Current Opinion in Lipidology, vol. 9, no. 6, pp. 613–615, 1998.
View at: Publisher Site | Google Scholar
Q. Shao, F. Han, S. Peng, and B. He, “Nur77 inhibits oxLDL induced apoptosis of macrophages via the p38 MAPK signaling pathway,” Biochemical and Biophysical Research Communications, vol. 471, no. 4, pp. 633–638, 2016.
View at: Publisher Site | Google Scholar
M. R. Paillasse and P. de Medina, “The NR4A nuclear receptors as potential targets for anti-aging interventions,” Medical Hypotheses, vol. 84, no. 2, pp. 135–140, 2015.
View at: Publisher Site | Google Scholar
L. C. Chao, K. Wroblewski, O. R. Ilkayeva et al., “Skeletal muscle Nur77 expression enhances oxidative metabolism and substrate utilization,” Journal of Lipid Research, vol. 53, no. 12, pp. 2610–2619, 2012.
View at: Publisher Site | Google Scholar
R. Rodriguez-Calvo, M. Tajes, and M. Vazquez-Carrera, “The NR4A subfamily of nuclear receptors: potential new therapeutic targets for the treatment of inflammatory diseases,” Expert Opinion on Therapeutic Targets, vol. 21, no. 3, pp. 291–304, 2017.
View at: Publisher Site | Google Scholar
H. Y. Huang, H. F. Chang, M. J. Tsai, J. S. Chen, and M. J. Wang, “6-Mercaptopurine attenuates tumor necrosis factor-α production in microglia through Nur77-mediated transrepression and PI3K/Akt/mTOR signaling-mediated translational regulation,” Journal of Neuroinflammation, vol. 13, no. 1, p. 78, 2016.
View at: Publisher Site | Google Scholar
A. Tenga, J. A. Beard, A. Takwi, Y. M. Wang, and T. Chen, “Regulation of nuclear receptor Nur77 by miR-124,” PLoS One, vol. 11, no. 2, article e0148433, 2016.
View at: Publisher Site | Google Scholar
A. K. Min, K. H. Bae, Y. A. Jung et al., “Orphan nuclear receptor Nur77 mediates fasting-induced hepatic fibroblast growth factor 21 expression,” Endocrinology, vol. 155, no. 8, pp. 2924–2931, 2014.
View at: Publisher Site | Google Scholar
J. Zheng, C. C. Wei, N. Hase et al., “Chymase mediates injury and mitochondrial damage in cardiomyocytes during acute ischemia/reperfusion in the dog,” PLoS One, vol. 9, no. 4, article e94732, 2014.
View at: Publisher Site | Google Scholar
H. Feng, W. Liu, R. Zhan, X. X. Wang, and L. J. Qian, “Changes of NGFI-B subcellular location in cardiomyocytes of stressed rats and its biological effects,” Zhongguo Ying Yong Sheng Li Xue Za Zhi, vol. 27, no. 3, pp. 289–293, 2011.
View at: Google Scholar
Z. Cheng, M. Völkers, S. Din et al., “Mitochondrial translocation of Nur77 mediates cardiomyocyte apoptosis,” European Heart Journal, vol. 32, no. 17, pp. 2179–2188, 2011.
View at: Publisher Site | Google Scholar
D. Campos-Melo, D. Galleguillos, N. Sánchez, K. Gysling, and M. E. Andrés, “Nur transcription factors in stress and addiction,” Frontiers in Molecular Neuroscience, vol. 6, 2013.
View at: Publisher Site | Google Scholar
Y. Katagiri, Y. Hirata, J. Milbrandt, and G. Guroff, “Differential regulation of the transcriptional activity of the orphan nuclear receptor NGFI-B by membrane depolarization and nerve growth factor,” The Journal of Biological Chemistry, vol. 272, no. 50, pp. 31278–31284, 1997.
View at: Publisher Site | Google Scholar
S. Bandoh, T. Tsukada, K. Maruyama, N. Ohkura, and K. Yamaguchi, “Mechanical agitation induces gene expression of NOR-1 and its closely related orphan nuclear receptors in leukemic cell lines,” Leukemia, vol. 11, no. 9, pp. 1453–1458, 1997.
View at: Publisher Site | Google Scholar
R. K. Chan, E. R. Brown, A. Ericsson, K. J. Kovács, and P. E. Sawchenko, “A comparison of two immediate-early genes, c-fos and NGFI-B, as markers for functional activation in stress-related neuroendocrine circuitry,” The Journal of Neuroscience, vol. 13, no. 12, pp. 5126–5138, 1993.
View at: Google Scholar
X. Xie, X. Song, S. Yuan et al., “Histone acetylation regulates orphan nuclear receptor NR4A1 expression in hypercholesterolaemia,” Clinical Science, vol. 129, no. 12, pp. 1151–1161, 2015.
View at: Publisher Site | Google Scholar
S. O. Lee, X. Li, S. Khan, and S. Safe, “Targeting NR4A1 (TR3) in cancer cells and tumors,” Expert Opinion on Therapeutic Targets, vol. 15, no. 2, pp. 195–206, 2010.
View at: Publisher Site | Google Scholar
B. Egarnes, M. R. Blanchet, and J. Gosselin, “Treatment with the NR4A1 agonist cytosporone B controls influenza virus infection and improves pulmonary function in infected mice,” PLoS One, vol. 12, no. 10, article e0186639, 2017.
View at: Publisher Site | Google Scholar
M. Hu, Q. Luo, G. Alitongbieke et al., “Celastrol-induced Nur77 interaction with TRAF2 alleviates inflammation by promoting mitochondrial ubiquitination and autophagy,” Molecular Cell, vol. 66, no. 1, pp. 141–153.e6, 2017.
View at: Publisher Site | Google Scholar
E. Hedrick, S. O. Lee, R. Doddapaneni, M. Singh, and S. Safe, “NR4A1 antagonists inhibit β1-integrin-dependent breast cancer cell migration,” Molecular and Cellular Biology, vol. 36, no. 9, pp. 1383–1394, 2016.
View at: Publisher Site | Google Scholar
K. Yoon, S. O. Lee, S. D. Cho, K. Kim, S. Khan, and S. Safe, “Activation of nuclear TR3 (NR4A1) by a diindolylmethane analog induces apoptosis and proapoptotic genes in pancreatic cancer cells and tumors,” Carcinogenesis, vol. 32, no. 6, pp. 836–842, 2011.
View at: Publisher Site | Google Scholar
L. Hao, J. Luan, D. Zhang et al., “Research on the in vitro anticancer activity and in vivo tissue distribution of Amoitone B nanocrystals,” Colloids and Surfaces. B, Biointerfaces, vol. 117, pp. 258–266, 2014.
View at: Publisher Site | Google Scholar
B. Kiss, K. Tóth, Z. Sarang, É. Garabuczi, and Z. Szondy, “Retinoids induce Nur77-dependent apoptosis in mouse thymocytes,” Biochimica et Biophysica Acta (BBA) - Molecular Cell Research, vol. 1853, no. 3, pp. 660–670, 2015.
View at: Publisher Site | Google Scholar
E. Roche, J. Buteau, I. Aniento, J. A. Reig, B. Soria, and M. Prentki, “Palmitate and oleate induce the immediate-early response genes c-fos and nur-77 in the pancreatic beta-cell line INS-1,” Diabetes, vol. 48, no. 10, pp. 2007–2014, 1999.
View at: Publisher Site | Google Scholar
L. Medzikovic, C. A. Schumacher, A. O. Verkerk et al., “Orphan nuclear receptor Nur77 affects cardiomyocyte calcium homeostasis and adverse cardiac remodelling,” Scientific Reports, vol. 5, no. 1, p. 15404, 2015.
View at: Publisher Site | Google Scholar
L. C. Chao, Z. Zhang, L. Pei, T. Saito, P. Tontonoz, and P. F. Pilch, “Nur77 coordinately regulates expression of genes linked to glucose metabolism in skeletal muscle,” Molecular Endocrinology, vol. 21, no. 9, pp. 2152–2163, 2007.
View at: Publisher Site | Google Scholar
M. A. Maxwell, M. E. Cleasby, A. Harding, A. Stark, G. J. Cooney, and G. E. O. Muscat, “Nur77 regulates lipolysis in skeletal muscle cells. Evidence for cross-talk between the beta-adrenergic and an orphan nuclear hormone receptor pathway,” Journal of Biological Chemistry, vol. 280, no. 13, pp. 12573–12584, 2005.
View at: Publisher Site | Google Scholar
T. Tomioka, H. Maruoka, H. Kawa et al., “The histone deacetylase inhibitor trichostatin A induces neurite outgrowth in PC12 cells via the epigenetically regulated expression of the nur77 gene,” Neuroscience Research, vol. 88, pp. 39–48, 2014.
View at: Publisher Site | Google Scholar
Y. Hu, Q. Zhan, H. X. Liu, T. Chau, Y. Li, and Y. J. Yvonne Wan, “Accelerated partial hepatectomy-induced liver cell proliferation is associated with liver injury in Nur77 knockout mice,” The American Journal of Pathology, vol. 184, no. 12, pp. 3272–3283, 2014.
View at: Publisher Site | Google Scholar
P. Uhrin, T. Perkmann, B. Binder, and G. Schabbauer, “ISG12 is a critical modulator of innate immune responses in murine models of sepsis,” Immunobiology, vol. 218, no. 9, pp. 1207–1216, 2013.
View at: Publisher Site | Google Scholar
L. Wang, X. Dong, W. Zhou, Q. Zeng, and Y. Mao, “PDGF-induced proliferation of smooth muscular cells is related to the regulation of CREB phosphorylation and Nur77 expression,” Journal of Huazhong University of Science and Technology Medical Sciences, vol. 31, no. 2, pp. 169–173, 2011.
View at: Publisher Site | Google Scholar
M. A. Navarro, L. Badimon, C. Rodriguez et al., “Trans-10,cis-12-CLA dysregulate lipid and glucose metabolism and induce hepatic NR4A receptors,” Frontiers in Bioscience, vol. 2, pp. 87–97, 2010.
View at: Google Scholar
C. Draney, A. E. Hobson, S. G. Grover, B. O. Jack, and J. S. Tessem, “Cdk5r1 overexpression induces primary β-cell proliferation,” Journal of Diabetes Research, vol. 2016, Article ID 6375804, 15 pages, 2016.
View at: Publisher Site | Google Scholar
A. Hobson, C. Draney, A. Stratford et al., “Aurora Kinase A is critical for the Nkx6.1 mediated β-cell proliferation pathway,” Islets, vol. 7, no. 1, article e1027854, 2015.
View at: Publisher Site | Google Scholar
J. S. Tessem, L. G. Moss, L. C. Chao et al., “Nkx6.1 regulates islet β-cell proliferation via Nr4a1 and Nr4a3 nuclear receptors,” Proceedings of the National Academy of Sciences of the United States of America, vol. 111, no. 14, pp. 5242–5247, 2014.
View at: Publisher Site | Google Scholar
L. Wang, F. Gong, X. Dong, W. Zhou, and Q. Zeng, “Regulation of vascular smooth muscle cell proliferation by nuclear orphan receptor Nur77,” Molecular and Cellular Biochemistry, vol. 341, no. 1-2, pp. 159–166, 2010.
View at: Publisher Site | Google Scholar
Z. Wei and H. H. Li, “IGFBP-3 may trigger osteoarthritis by inducing apoptosis of chondrocytes through Nur77 translocation,” International Journal of Clinical and Experimental Pathology, vol. 8, no. 12, pp. 15599–15610, 2015.
View at: Google Scholar
S. Zhao, L. Zhou, G. Niu, Y. Li, D. Zhao, and H. Zeng, “Differential regulation of orphan nuclear receptor TR3 transcript variants by novel vascular growth factor signaling pathways,” The FASEB Journal, vol. 28, no. 10, pp. 4524–4533, 2014.
View at: Publisher Site | Google Scholar
T. J. Fahrner, S. L. Carroll, and J. Milbrandt, “The NGFI-B protein, an inducible member of the thyroid/steroid receptor family, is rapidly modified posttranslationally,” Molecular and Cellular Biology, vol. 10, no. 12, pp. 6454–6459, 1990.
View at: Publisher Site | Google Scholar
F. F. Zhou, Y. Drabsch, T. J. A. Dekker et al., “Nuclear receptor NR4A1 promotes breast cancer invasion and metastasis by activating TGF-β signalling,” Nature Communications, vol. 5, p. 3388, 2014.
View at: Publisher Site | Google Scholar
L. Pei, A. Castrillo, M. Chen, A. Hoffmann, and P. Tontonoz, “Induction of NR4A orphan nuclear receptor expression in macrophages in response to inflammatory stimuli,” The Journal of Biological Chemistry, vol. 280, no. 32, pp. 29256–29262, 2005.
View at: Publisher Site | Google Scholar
R. C. Borghaei, R. S. Sinai, E. Mochan, and E. A. Pease, “Induction of mitogen-inducible nuclear orphan receptor by interleukin 1 in human synovial and gingival fibroblasts,” Biochemical and Biophysical Research Communications, vol. 251, no. 1, pp. 334–338, 1998.
View at: Publisher Site | Google Scholar
L. C. Chao, S. J. Bensinger, C. J. Villanueva, K. Wroblewski, and P. Tontonoz, “Inhibition of adipocyte differentiation by Nur77, Nurr1, and Nor1,” Molecular Endocrinology, vol. 22, no. 12, pp. 2596–2608, 2008.
View at: Publisher Site | Google Scholar
M. Berriel Diaz, U. Lemke, and S. Herzig, “Discovering orphans’ sweet secret: NR4A receptors and hepatic glucose production,” Cell Metabolism, vol. 4, no. 5, pp. 339-340, 2006.
View at: Publisher Site | Google Scholar
L. Pei, H. Waki, B. Vaitheesvaran, D. C. Wilpitz, I. J. Kurland, and P. Tontonoz, “NR4A orphan nuclear receptors are transcriptional regulators of hepatic glucose metabolism,” Nature Medicine, vol. 12, no. 9, pp. 1048–1055, 2006.
View at: Publisher Site | Google Scholar
X. L. Bian, H. Z. Chen, P. B. Yang et al., “Nur77 suppresses hepatocellular carcinoma via switching glucose metabolism toward gluconeogenesis through attenuating phosphoenolpyruvate carboxykinase sumoylation,” Nature Communications, vol. 8, article 14420, 2017.
View at: Publisher Site | Google Scholar
L. C. Chao, K. Wroblewski, Z. Zhang et al., “Insulin resistance and altered systemic glucose metabolism in mice lacking Nur77,” Diabetes, vol. 58, no. 12, pp. 2788–2796, 2009.
View at: Publisher Site | Google Scholar
M. Bai, Y. Liu, F. Zhou et al., “Berberine inhibits glucose oxidation and insulin secretion in rat islets,” Endocrine Journal, 2018.
View at: Publisher Site | Google Scholar
F. Zhou, M. Bai, Y. Zhang et al., “Berberine-induced activation of AMPK increases hepatic FGF21 expression via NUR77,” Biochemical and Biophysical Research Communications, vol. 495, no. 2, pp. 1936–1941, 2018.
View at: Publisher Site | Google Scholar
S.-C. M. Wang and G. E. O. Muscat, “Nuclear receptors and epigenetic signaling: novel regulators of glycogen metabolism in skeletal muscle,” IUBMB Life, vol. 65, no. 8, pp. 657–664, 2013.
View at: Publisher Site | Google Scholar
T. Kanzleiter, E. Preston, D. Wilks et al., “Overexpression of the orphan receptor Nur77 alters glucose metabolism in rat muscle cells and rat muscle in vivo,” Diabetologia, vol. 53, no. 6, pp. 1174–1183, 2010.
View at: Publisher Site | Google Scholar
O. Cortez-Toledo, C. Schnair, P. Sangngern, D. Metzger, and L. C. Chao, “Nur77 deletion impairs muscle growth during developmental myogenesis and muscle regeneration in mice,” PLoS One, vol. 12, no. 2, article e0171268, 2017.
View at: Publisher Site | Google Scholar
P. Tontonoz, O. Cortez-Toledo, K. Wroblewski et al., “The orphan nuclear receptor Nur77 is a determinant of myofiber size and muscle mass in mice,” Molecular and Cellular Biology, vol. 35, no. 7, pp. 1125–1138, 2015.
View at: Publisher Site | Google Scholar
S. A. Myers, N. Eriksson, R. Burow, S. C. M. Wang, and G. E. O. Muscat, “Beta-adrenergic signaling regulates NR4A nuclear receptor and metabolic gene expression in multiple tissues,” Molecular and Cellular Endocrinology, vol. 309, no. 1-2, pp. 101–108, 2009.
View at: Publisher Site | Google Scholar
Y. Fu, L. Luo, N. Luo, X. Zhu, and W. T. Garvey, “NR4A orphan nuclear receptors modulate insulin action and the glucose transport system: potential role in insulin resistance,” The Journal of Biological Chemistry, vol. 282, no. 43, pp. 31525–31533, 2007.
View at: Publisher Site | Google Scholar
T. Kanzleiter, D. Wilks, E. Preston, J. Ye, G. Frangioudakis, and G. J. Cooney, “Regulation of the nuclear hormone receptor nur77 in muscle: influence of exercise-activated pathways in vitro and obesity in vivo,” Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease, vol. 1792, no. 8, pp. 777–782, 2009.
View at: Publisher Site | Google Scholar
X. Wu, J. Wang, X. Cui et al., “The effect of insulin on expression of genes and biochemical pathways in human skeletal muscle,” Endocrine, vol. 31, no. 1, pp. 5–17, 2007.
View at: Publisher Site | Google Scholar
S. Susini, E. Roche, M. Prentki, and W. Schlegel, “Glucose and glucoincretin peptides synergize to induce c-fos, c-jun, junB, zif-268, and nur-77 gene expression in pancreatic β(INS-1) cells,” The FASEB Journal, vol. 12, no. 12, pp. 1173–1182, 1998.
View at: Publisher Site | Google Scholar
O. Briand, A. Helleboid-Chapman, M. Ploton et al., “The nuclear orphan receptor Nur77 is a lipotoxicity sensor regulating glucose-induced insulin secretion in pancreatic β-cells,” Molecular Endocrinology, vol. 26, no. 3, pp. 399–413, 2012.
View at: Publisher Site | Google Scholar
M. S. Reynolds, C. R. Hancock, J. D. Ray et al., “β-Cell deletion of Nr4a1 and Nr4a3 nuclear receptors impedes mitochondrial respiration and insulin secretion,” American Journal of Physiology Endocrinology and Metabolism, vol. 311, no. 1, pp. E186–E201, 2016.
View at: Publisher Site | Google Scholar
Y. T. Chen, J. W. Liao, Y. C. Tsai, and F. J. Tsai, “Inhibition of DNA methyltransferase 1 increases nuclear receptor subfamily 4 group A member 1 expression and decreases blood glucose in type 2 diabetes,” Oncotarget, vol. 7, no. 26, pp. 39162–39170, 2016.
View at: Publisher Site | Google Scholar
Y. W. Hu, P. Zhang, J. Y. Yang et al., “Nur77 decreases atherosclerosis progression in apoE^−/− mice fed a high-fat/high-cholesterol diet,” PLoS One, vol. 9, no. 1, article e87313, 2014.
View at: Publisher Site | Google Scholar
T. W. H. Pols, R. Ottenhoff, M. Vos et al., “Nur77 modulates hepatic lipid metabolism through suppression of SREBP1c activity,” Biochemical and Biophysical Research Communications, vol. 366, no. 4, pp. 910–916, 2008.
View at: Publisher Site | Google Scholar
P. Zhang, Y. Hu, J. Yang, L. Zheng, and Q. Wang, “The orphan nuclear receptor Nur77 regulates hepatic cholesterol metabolism through the suppression of LDLR and HMGCR expression,” Molecular Medicine Reports, vol. 5, no. 6, pp. 1541–1547, 2012.
View at: Publisher Site | Google Scholar
T. Kudo, E. Nakayama, S. Suzuki, M. Akiyama, and S. Shibata, “Cholesterol diet enhances daily rhythm of Pai-1 mRNA in the mouse liver,” American Journal of Physiology Endocrinology and Metabolism, vol. 287, no. 4, pp. E644–E651, 2004.
View at: Publisher Site | Google Scholar
S. Perez-Sieira, G. Martinez, B. Porteiro et al., “Female Nur77-deficient mice show increased susceptibility to diet-induced obesity,” PLoS One, vol. 8, no. 1, article e53836, 2013.
View at: Publisher Site | Google Scholar
S. J. Lessard, D. A. Rivas, E. J. Stephenson et al., “Exercise training reverses impaired skeletal muscle metabolism induced by artificial selection for low aerobic capacity,” American Journal of Physiology Regulatory, Integrative and Comparative Physiology, vol. 300, no. 1, pp. R175–R182, 2011.
View at: Publisher Site | Google Scholar
S. J. Lessard, D. A. Rivas, Z. P. Chen et al., “Impaired skeletal muscle β-adrenergic activation and lipolysis are associated with whole-body insulin resistance in rats bred for low intrinsic exercise capacity,” Endocrinology, vol. 150, no. 11, pp. 4883–4891, 2009.
View at: Publisher Site | Google Scholar
T. J. Schulz, P. Huang, T. L. Huang et al., “Brown-fat paucity due to impaired BMP signalling induces compensatory browning of white fat,” Nature, vol. 495, no. 7441, pp. 379–383, 2013.
View at: Publisher Site | Google Scholar
S. Collins, W. Cao, and J. Robidoux, “Learning new tricks from old dogs: β-adrenergic receptors teach new lessons on firing up adipose tissue metabolism,” Molecular Endocrinology, vol. 18, no. 9, pp. 2123–2131, 2004.
View at: Publisher Site | Google Scholar
T. Kanzleiter, T. Schneider, I. Walter et al., “Evidence for Nr4a1 as a cold-induced effector of brown fat thermogenesis,” Physiological Genomics, vol. 24, no. 1, pp. 37–44, 2005.
View at: Publisher Site | Google Scholar
N. Kumar, D. Liu, H. Wang, J. Robidoux, and S. Collins, “Orphan nuclear receptor NOR-1 enhances 3,5-cyclic adenosine 5-monophosphate-dependent uncoupling protein-1 gene transcription,” Molecular Endocrinology, vol. 22, no. 5, pp. 1057–1064, 2008.
View at: Publisher Site | Google Scholar
T. Fumoto, T. Yamaguchi, F. Hirose, and T. Osumi, “Orphan nuclear receptor Nur77 accelerates the initial phase of adipocyte differentiation in 3T3-L1 cells by promoting mitotic clonal expansion,” Journal of Biochemistry, vol. 141, no. 2, pp. 181–192, 2007.
View at: Publisher Site | Google Scholar
S. K. Kolluri, X. Zhu, X. Zhou et al., “A short Nur77-derived peptide converts Bcl-2 from a protector to a killer,” Cancer Cell, vol. 14, no. 4, pp. 285–298, 2008.
View at: Publisher Site | Google Scholar
L. Zhang, W. Liu, Q. Wang et al., “New drug candidate targeting the 4A1 orphan nuclear receptor for medullary thyroid cancer therapy,” Molecules, vol. 23, no. 3, 2018.
View at: Publisher Site | Google Scholar
S. Safe, U. H. Jin, B. Morpurgo, A. Abudayyeh, M. Singh, and R. B. Tjalkens, “Nuclear receptor 4A (NR4A) family - orphans no more,” The Journal of Steroid Biochemistry and Molecular Biology, vol. 157, pp. 48–60, 2016.
View at: Publisher Site | Google Scholar
L. H. Hu, Y. Yu, S. X. Jin et al., “Orphan nuclear receptor Nur77 inhibits oxidized LDL-induced differentiation of RAW264.7 murine macrophage cell line into dendritic like cells,” BMC Immunology, vol. 15, no. 1, p. 54, 2014.
View at: Publisher Site | Google Scholar
J. D. Hawk, A. L. Bookout, S. G. Poplawski et al., “NR4A nuclear receptors support memory enhancement by histone deacetylase inhibitors,” The Journal of Clinical Investigation, vol. 122, no. 10, pp. 3593–3602, 2012.
View at: Publisher Site | Google Scholar
R. Rodríguez-Calvo, B. Ferrán, J. Alonso et al., “NR4A receptors up-regulate the antiproteinase alpha-2 macroglobulin (A2M) and modulate MMP-2 and MMP-9 in vascular smooth muscle cells,” Thrombosis and Haemostasis, vol. 113, no. 06, pp. 1323–1334, 2017.
View at: Publisher Site | Google Scholar
A. Mildner, J. Schönheit, A. Giladi et al., “Genomic characterization of murine monocytes reveals C/EBPβ transcription factor dependence of Ly6C⁻ cells,” Immunity, vol. 46, no. 5, pp. 849–862.e7, 2017.
View at: Publisher Site | Google Scholar
M. D. Mumau, A. N. Vanderbeck, E. D. Lynch, S. B. Golec, S. G. Emerson, and J. A. Punt, “Identification of a multipotent progenitor population in the spleen that is regulated by NR4A1,” Journal of Immunology, vol. 200, no. 3, pp. 1078–1087, 2018.
View at: Publisher Site | Google Scholar

Copyright

Copyright © 2018 Lei Zhang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation

Download other formats

Order printed copies

Views

4078

Downloads

1597

Citations