Research Article
Composition of High Molecular Weight Glutenin Subunits in Polish Common Wheat Cultivars (Triticum aestivum L.)
Table 1
Sets of alleles: specific markers for the identification of wheat HMW glutenin genes used in the study.
| Genes | Forward and reverse primer sequences (5′-3′) | Expected DNA fragment | References |
| 1Dx2 or 1Dx5 | F: GCCTAGCAACCTTCACAATC R: GAAACCTGCTGCGGACAAG | 413–430 bp or 450 bp | D’Ovidio and Anderson [5] | 1Dy10 or 1Dy12 | F: GTTGGCCGGTCGGCTGCCATG R: TGGAGAAGTTGGATAGTACC | 400 bp or 612 bp | Ahmad [6]
|
|
|