Journal of Food Quality

Journal of Food Quality / 2019 / Article

Research Article | Open Access

Volume 2019 |Article ID 4693513 | https://doi.org/10.1155/2019/4693513

Başar Uymaz Tezel, "Preliminary In Vitro Evaluation of the Probiotic Potential of the Bacteriocinogenic Strain Enterococcus lactis PMD74 Isolated from Ezine Cheese", Journal of Food Quality, vol. 2019, Article ID 4693513, 12 pages, 2019. https://doi.org/10.1155/2019/4693513

Preliminary In Vitro Evaluation of the Probiotic Potential of the Bacteriocinogenic Strain Enterococcus lactis PMD74 Isolated from Ezine Cheese

Academic Editor: Barbara Speranza
Received21 Jan 2019
Revised28 Mar 2019
Accepted30 Apr 2019
Published19 May 2019

Abstract

Ezine cheese is a nonstarter and long-ripened cheese produced in the Mount of Ida region of Çanakkale, Turkey, with a protected designation of origin (PDO) status. The nonstarter fermented foods serve as sources for the isolation of novel strains. The present study aimed to report the novelty of the bacteriocinogenic Enterococcus lactis PMD74 strain and the in vitro assessment of its potential as a probiotic candidate. Additionally, the present study aimed to describe the technological and safety-related properties of the aforementioned strain. The strain exhibited high viability at pH 3.0, in the presence of pepsin, pancreatin, and bile salts (0.3% and 0.5%), and considerable survival passage through the stimulated digestion tests. The strain PMD74 exhibited substantial autoaggregative (41%) and coaggregative properties, which increased as a function of time. The highest coaggregation percentage was obtained with Salmonella enterica serotype Typhimurium SL1344 (23%), followed by Staphylococcus aureus ATCC 6538 (10.3%) and Escherichia coli ATCC 26922 (7.4%), respectively. The strain PMD74 was able to inhibit the growth of a number of Gram-positive bacteria, including Listeria monocytogenes, Lactobacillus sake, Staphylococcus aureus, and E. faecalis. The antimicrobial activity of the proteinaceous compound was calculated as 6400 AU·mL−1 by the critical dilution method against E. faecalis ATTC 29212. γ-Hemolytic PMD74 was observed to be sensitive to vancomycin, ampicillin, penicillin, gentamicin, tetracycline, chloramphenicol, and tylosin. Among the four genes tested, E. lactis PMD74 was observed to be positive for three virulence determinants, ace, sprE, and gelE, and negative for esp. The amino acid decarboxylase activities were detected negative for histidine, tyrosine, and ornithine. E. lactis PMD74 was classified as a low acidifier, which suggested its possible role as an adjunct culture. E. lactis PMD74 exhibited considerable survival ability (8.86 log CFU·mL−1) in the acidic condition of fermented milk for a four-week-long storage period.

1. Introduction

The bacteria belonging to genus Enterococcus form the third largest group of lactic acid bacteria (LAB), with the genera Lactobacillus and Streptococcus being the first and the second largest ones. The members of this group are Gram-positive, facultative anaerobic, and coccus-shaped, and were initially classified as group D streptococci. These bacteria are able to grow in the presence of 6.5% NaCl, 40% bile salts, and at pH 9.6 and are able to survive for 30 min at 60°C [1]. To date, 58 species and 2 subspecies have been identified and classified within the genus Enterococcus [2]. The species belonging to the genus Enterococcus, Enterococcus faecalis and Enterococcus faecium in particular (with counts ranging from 105 to 107 CFU·g−1 and from 104 to 105 CFU·g−1, respectively), constitute a large proportion of the autochthonous flora of mammalian gastrointestinal (GI) tract [3]. Enterococci are able to form colonies in various niches, such as soil, water, sewage, and plants, because of their exceptional ability of resistance and growth in the extraenteric environments [4]. Enterococci may contaminate raw milk or meat through intestinal or environmental contamination and may become an important part of the fermented food microflora due to their ability to survive in harsh conditions, such as extreme pH and temperatures, and salinity [3, 4].

The species belonging to the genus Enterococcus may present as nonstarter LAB flora in a variety of traditional cheese prepared from both raw and pasteurized milk, such as Cheddar, Feta, Water-buffalo Mozarella, Cebreiro, Venaco, and Hispanico [1, 3]. It has been reported that the count of enterococci in the traditional cheese from Mediterranean countries may range from 104 to 106 CFU·g−1 in curd and from 105 to 107 CFU·g−1 in fully ripened cheese [3]. Enterococci contribute to ripening and the development of aroma in cheese, through the processes of proteolysis, lipolysis, and citrate breakdown [1]. Additionally, the ability of enterococci to produce antimicrobial substances such as lactic acid, hydrogen peroxide, and bacteriocins (enterocins) provides a great advantage to the food they are present in [4, 5]. It has been well documented that the use of bacteriocins as biopreservatives extends the shelf life of foods and inhibits the proliferation of harmful bacteria such as Listeria monocytogenes, Staphylococcus aureus, and Clostridium botulinum [4, 6]. In addition to the studies emphasizing the aforementioned technological properties of enterococci, several types of research have focused on the potential probiotic properties and the health-promoting effects of enterococci [5, 79]. According to FAO/WHO [10], several probiotic strains (mainly from the Lactobacillus and Bifidobacterium spp.) have been investigated in terms of their ability to survive during passage through the GI tract of the consumer, as well as for their ability to conserve their beneficial properties during the production and commercialization of the product containing them.

The strains of enterococci have been used as probiotics to a considerably smaller extent. E. faecalis Symbioflor 1 (SymbioPharm, Herborn, Germany) and E. faecium SF68 (NCIMB 10415; Cerbios-Pharma SA, Barbengo, Switzerland) have been the established enterococcal probiotics and produced in the form of pharmaceutical preparations [4, 11]. Although the technological and health-promoting properties of enterococci portray these bacteria as an interesting constituent for the development of starter or coculture in the production of fermented foods, the genus Enterococcus, contrary to the other LAB, is not considered “generally recognized as safe” (GRAS) [12]. The safe use of enterococci, which are also known to be opportunistic pathogens, remains controversial as these bacteria are one of the major causes of nosocomial infections [4, 13]. The presence of virulence factors, which are carried mainly by E. faecalis and to a lesser extent by E. faecium, has also been a cause for concern [14]. In this respect, the research works on the isolation of novel enterococcal strains other than E. faecalis as well as on their biotechnological and safety potentials hold great importance, especially in the Mediterranean nations. E. lactis, which was first isolated in Russian sour milk products [15], and later in South African fresh sheep milk [16], was described by Morandi et al. [17] as a novel species belonging to genus Enterococcus. In several studies conducted by different research groups, the biotechnological, probiotic, and safety-related properties, as well as the bacteriocin-producing potential of E. lactis, have been investigated [6, 8, 9, 18, 19].

Ezine cheese is a type of nonstarter, long-ripened white cheese with a protected designation of origin (PDO) status. Ezine cheese is produced from a mixture of the pasteurized ewe (approximately 45%–55%), goat milk (at least 40%), and cow milk (at most 15%), in the Mount of Ida region of Çanakkale, Turkey [20]. It is well known that the nonstarter fermented foods serve as sources for the isolation of both potential probiotic and potential bacteriocinogenic novel strains [14]. The present study aimed to report (i) the novelty of the bacteriocinogenic E. lactis strain isolated from Ezine cheese (PDO), (ii) the in vitro assessment of the potential of this strain as a probiotic candidate, and (iii) the details of the technological and safety properties of the strain. The present study, to the best of our knowledge, is the pioneer study on the isolation of an E. lactis strain from dairy products in Turkey and on the evaluation of the probiotic and bacteriocinogenic potentials of the strain. The findings of the present study suggest potential applications of this strain as a novel probiotic strain or/and a biopreservative in the food industry.

2. Materials and Methods

2.1. Bacterial Strains and Growth Media

Table 1 enlists the source and the growth conditions of the indicator strains that were used in the present study. All the indicator strains were stored at −80°C in their corresponding suitable broths supplemented with 30% glycerol. The working cultures for each strain were prepared by transferring the respective frozen culture to the appropriate broth, followed by overnight incubation.


StrainsSourceaGrowth conditionsbAntimicrobial activityc
Agar spot testWell diffusion

Lactobacillus plantarum LMG2003NLHMRS, 37°C+++NZ
Lactobacillus sake NCDO2714NLHMRS, 37°C++++++
Lactococcus lactis SIK83NLHM17, 30°CNZNZ
Pediococcus pentosaceus FBB611NLHMRS, 37°C+++++
Pediococcus pentosaceus BH105AUFFMRS, 37°CNZNZ
Bifidobacterium longum CHL28NLHMRS, 37°C++NZ
Bacillus cereus FM1NLHLB, 37°CNZNZ
Listeria monocytogenes ATCC 7644AUFFLB, 37°C++++++
Staphylococcus aureus ATCC 6538AUFFLB, 37°C+++++
Salmonella enterica serotype Typhimurium SL1344AUFFLB, 37°C+++NZ
Micrococcus luteus NCIMB8166AUFFLB, 37°CNZNZ
Enterococcus faecalis LMG2708NLHBHI, 37°C+++++
Enterococcus faecalis ATCC 29212AUFFBHI, 37°C+++++
Escherichia coli ATCC 26922AUFFLB, 37°C+++++
Escherichia coli LMG3083 ETECNLHLB, 37°C+++++

aNLH: Agricultural University of Norway; AUFF: Faculty of Science, University of Ankara, Tukey. bMRS: de Man Rogosa Sharpe (Merck, Germany); BHI: brain heart infusion (Merck, Germany); LB: Luria Bertani (Merck, Germany); M17 (Merck, Germany). cNZ: no inhibition zone (diameters of inhibition zones are +: 1–5 mm, ++: 6–10 mm, and +++: ≥11 mm).
2.2. Isolation and Identification of the Potential Probiotic Strain

Ezine cheese samples were homogenized and diluted in sterile ¼ strength Ringer’s solution (Merck, Germany) and were plated on kanamycin aesculin azide agar (KAA, Merck, Germany), followed by aerobic incubation at 37°C for 48 h. Subsequent to incubation, colonies with morphology typical to Enterococcus were selected randomly and spotted onto plates containing brain heart infusion (BHI; Merck, Germany) agar using sterile toothpicks. After an overnight incubation, 5 mL BHI soft agar (0.7%, w/v) containing 106 CFU·mL−1 count of the indicator strains (E. faecalis ATCC 29212 and E. faecalis LMG2708) was poured into the plates, followed by further incubation [21]. The colony exhibiting a clear inhibition zone (against the indicator strain) larger than 10 mm in diameter was isolated, purified using same media, and then was stored in BHI broth containing 20% (v/v) glycerol at −20°C for further investigations. Gram staining, catalase reaction, growth at different temperatures (10 and 45°C) and at pH 9.6, and growth in the presence of NaCl (6.5%), bile salt (40%), and aesculin hydrolyse (Bile Aesculin Agar; Merck, Germany) were the experiments that were performed for the preliminary identification of the strain. In order to determine the carbohydrate utilization profile of the isolate, API 20 Strep system (BioMérieux Inc., France) was used, in accordance with the manufacturer’s recommendations, and the result was analyzed using APILAB Plus version 1.2.1 (BioMĕrieux Inc., France). Genetic identification of the isolate was performed using 16S rRNA sequence analysis. In this analysis, the genomic DNA of the samples was isolated according to the method described by Cancilla et al. [22], and the region between nucleotide 8 and nucleotide 928 in the 16S rDNA gene was amplified through polymerase chain reaction (PCR) using universal primers (Table 2). The PCR product thus obtained was sequenced by MedSanTek (Istanbul, Turkey) after post purification (Thermo Fischer Scientific, USA). Basic local alignment search tool (BLAST) was employed to compare the similarity of the sequences against the nucleotide database available in the National Centre for Biotechnology Information (NCBI). All the tests were performed in duplicate in order to confirm their reproducibility and E. faecalis ATCC 29212 was used as the control for both biochemical and genetic identification.


Target genePrimer setsProduct size (bp)Reference

16S rRNAF: CCGTCAATTCCTTTGAGTTT928[23]
R: AGAGTTTGATCCTGGCTCAG
espTE34: TTGCTAATGCTAGTCCACGACC933[24]
TE36: GCGTCAACACTTGCATTGCCGAA
aceF: GAATTGAGCAAAAGTTCAATCG1008[25]
R: GTCTGTCTTTTCACTTGTTTC
sprEF: TTGAGCTCCGTTCCTGCCGAAAGTCATTC591[26]
R: TTGGTACCGATTGGGGAACCAGATTGACC
gelETE9: ACCCCGTATCATTGGTTT419[24]
TE10: ACGCATTGCTTTTCCATC

2.3. In Vitro Evaluation of Probiotic Properties and Safety of the Strain
2.3.1. Tolerance of Strain through the Simulated Gastrointestinal Tract

The tolerance of the selected strain through the human upper GI system was assessed by using an in vitro model that stimulated gastric and pancreatic juices, as described previously in a report by Conway et al. [27]. Briefly, bacterial cells in their logarithmic phase were harvested through centrifugation (10,000 × g for 5 min at 4°C) and washed three times with phosphate buffered saline (PBS; pH 7.2). In order to determine tolerance to pH, the cells were resuspended in PBS with pH 2.0 and 3.0 (pH adjusted using 5 mmol·L−1 HCl) and the tolerance to pepsin was determined by resuspending the cells in PBS containing pepsin (3 mg·mL−1; Merck) at pH 2.0 and 3.0. The resistance was evaluated in terms of viable colony counts (expressed as Log CFU·mL−1) using plate count on MRS agar after incubation at 37°C for 0, 1, 2, and 3 h, the time durations reflecting the time spent by food in the stomach. Resistance to pancreatin (1 mg·mL−1, pH 8.0; Merck, Germany) and resistance to 0.3% and 0.5% (w/v) bile salts (Sigma-Aldrich, Germany) were assessed in order to determine the tolerance of the E. lactis PMD74 strain to the intestinal juice [28].

Transit tolerance of the strain in the digestive system was determined through the sequential incubation of the bacterial suspension in solutions simulating oral cavity, gastric compartment, and intestinal compartments [29]. Briefly, bacterial cells prepared as described earlier were incubated with lysozyme solution at a final concentration of 100 ppm for 5 min in order to simulate the possible hydrolysis in the oral cavity. Subsequently, the cells were harvested and incubated with simulated gastric fluid (PBS containing 3 mg·mL−1 pepsin at pH 3.0) for 90 min. Finally, following the incubation at 37°C, the cells were harvested and resuspended in PBS containing 1 mg·mL−1 pancreatin and 0.3% or 0.5% (w/v) bile salt at pH 8.0, which simulated intestinal digestion conditions. The samples were incubated at 37°C for 150 min. The cell viability was evaluated through plate counting using the samples collected prior to and after oral, gastric, and intestinal digestion. The experiments were performed three times independently.

2.3.2. Bile Salt Hydrolysis (BSH) and Mucin Degradation Activity

The overnight bacterial culture was grown on MRS agar containing 0.5% (w/v) taurodeoxycholic acid (TDCA; Sigma-Aldrich, Germany) using the streaking method. After 48 h of incubation at 37°C, the hydrolysis effect was indicated by a colony morphology different (partial hydrolysis) from that observed in the control MRS plates [30].

The potential of the strain to degrade gastric mucin was in vitro evaluated following the plate procedure developed by Zhou et al. [31]. Salmonella enterica ssp. Enterica serovar Typhimurium ATCC 14028 was used as positive control. The experiments were performed three times independently.

2.3.3. Determination of Cell Surface Characteristics

The autoaggregation (Auto-A%) and coaggregation (Co-A%) abilities of the strain were assessed using the method described previously by Collado et al. [32] and were expressed as the percentage of the total number of bacteria present. Briefly, the stationary-phase culture was centrifuged (6000 × g, 15 min), washed, and resuspended in PBS to reach a count of 108 CFU·mL−1, followed by incubation in aliquots at room temperature (20 ± 1°C). In order to determine the percentage of autoaggregation, absorbance was monitored at different time points (4, 18, and 24 h) in a spectrophotometer (Shimadzu, Japan) at a wavelength of 600 nm and was calculated by using the following equation:where is the absorbance at 600 nm at time point and is the absorbance at time zero.

In order to evaluate the coaggregation percentage, E. coli ATCC 26922, S. enterica serotype Typhimurium SL1344, and S. aureus ATCC 6538 were used as the coaggregation partners. Cell suspensions were prepared as described earlier, and equal volumes (2 mL) of the cell suspensions of presumptive probiotic and pathogenic strains were mixed and incubated at room temperature (20 ± 1°C) for 4 h without agitation. Cell suspensions of each strain were used as controls. The absorbance of the probiotic (pro) and pathogenic (pat) strains in the control and mixture (mix) tubes was measured at 600 nm. Percentage of coaggregation was calculated using the following equation:

Standard deviations were derived from the coaggregation values of three independent experiments.

2.3.4. Screening of Antimicrobial Activity

Agar spot test [33] and well diffusion [34] methods were used to evaluate the antimicrobial activity of the strain. Briefly, colonies from an overnight culture were seeded onto the surface of MRS agar and incubated at 37°C for 24 h. The bacterial strains used as indicators (Table 1) were inoculated (approximate count: 105–106 CFU·mL−1) into BHI, MRS, M17, and LB soft agar and poured over the plates. In order to perform the well diffusion assay, the cell-free supernatant (CFS) of an overnight culture was obtained by centrifugation (10,000 × g, 15 min, 4°C). Subsequent to the pH adjustment to 6.5 using 1 mmol·L−1 NaOH, the CFS was sterilized using 0.45 μm pore size membrane filter (Millipore, France). The sterilized CFS (100 μL) was placed into wells that were cutout on the medium containing the indicator strains in the plates. After 24 h of incubation at the optimal growth temperature of the respective indicator strains, the plates were examined for inhibition zones. The diameters (mm) of the inhibition zones were scored as: NZ (No inhibition zone), + (a clear zone of 1–5 mm), ++ (a clear zone of 6–10 mm), and +++ (a clear zone of ≥11 mm). In order to determine the proteinous structure of the CFS, it was treated with the proteolytic enzymes proteinase-K (Thermo Fisher Scientific, USA), trypsin (Sigma-Aldrich, Germany), and catalase (Sigma-Aldrich, Germany), at a final concentration of 1 mg·mL−1, against the indicator strain E. faecalis ATCC 29212. The bacteriocinogenic activity was measured using the critical dilution method proposed by Daba et al. [35]. Three independent experiments were performed.

2.3.5. Antibiotic Susceptibility and Hemolytic and Gelatinase Activity

The antibiotic susceptibility of the E. lactis PMD74 strain was determined using the disk diffusion method on Mueller–Hinton Agar (Merck) as described previously [36]. The antibiotics, which were selected according to the recommendations provided by the European Food Safety Authority (EFSA) [37], are listed in Table 3. The level of susceptibility to the tested antibiotics was expressed as resistant, intermediate, or sensitive, according to the guidelines provided by the Clinical and Laboratory Standards Institute [38] and EFSA [37].


Group numberaAntibioticConcentration (μg/mL) (Oxoid)Strainsb
E. lactis PMD74S. aureus ATCC 6538

IPenicillin G10 USR
Ampicillin10SR
Vancomycin30SR

IIGentamicin10SR
Kanamycin30RR
Streptomycin10RR
Tetracycline30SS
Chloramphenicol30SS
Erythromycin15IR
Clindamycin2RR
Tylosin30SR

IIIRifampicin5SR

aGroup I: cell wall synthesis inhibitors; group II: protein synthesis inhibitors; group III: nucleic acid synthesis inhibitors. bSusceptibility is expressed as resistant (R), intermediate (I), and sensitive (S) (CLSI, 2012, EFSA 2018).

The overnight culture was grown on the surface of Columbia blood agar plates (Oxoid) containing 5% (w/v) sheep blood using the streaking method, and the plates were then incubated at 37°C for 48 h. The plates were subsequently examined for the hemolytic reaction.

To determine the presence of gelatinase activity, the overnight culture was streaked on the surface of Todd–Hewitt agar (Merck, Germany) containing gelatin (30 g·L−1; Merck, Germany) and the plates were incubated overnight at 37°C. The zones of turbidity around the colonies were examinated.

In both experiments, S. aureus ATCC 6538 was used as the control strain, and the tests were performed in triplicate.

2.3.6. Screening for the Presence of Virulence Genes

The PCR screening of the E. lactis PMD74 strain for virulence genes was conducted targeting specific virulence factors esp (enterococcal surface protein), ace (collagen-binding protein), sprE (serine protease), and gelE (gelatinase) using the primer sets listed in Table 2. E. faecalis ATCC 29212 and OG1RF strains were used as positive controls. Genomic DNA was isolated from the overnight cultures as described earlier. The amplification products were separated on a 1.5% agarose gel containing ethidium bromide (0.5 mg·mL−1) in 0.5X TAE buffer for 30 min at 100 V and were visualized in UV light using Kodak Gel Logic 200 Imaging System (Kodak, USA). The O’GeneRuler 100 bp DNA molecular weight ladder (Fermentas, Finland) was used as the standard for size.

2.3.7. Amino Acid Decarboxylase Detection

Modified decarboxylase base broth medium, the preparation of which has been described previously by Maijala [39], was used for the determination of the decarboxylase activity of the potential probiotic strain. The corresponding amino acids (L-histidine monohydrochloride (Sigma-Aldrich, Germany), L-tyrosine (Sigma-Aldrich, Germany), L-ornithine monohydrochloride (Sigma-Aldrich, Germany), and L-arginine monohydrochloride (Merck, Germany)) were added individually to the medium at a final concentration of 0.5% (w/v), and purple bromocresol was added as the pH indicator. The overnight culture was inoculated (2%) into the same medium with or without the corresponding amino acids. The amino acid-free medium was used as the control. After incubation at 37°C for three days, while the color was yellow in the control tubes, the conversion of the color to purple in the tubes containing amino acids was considered an amino acid decarboxylase positive reaction. The experiments were performed in triplicate independently.

2.4. Technological Properties
2.4.1. Acidifying Activity and Viability in Fermented Milk

The strain was evaluated for its acidifying activity, which is the ability to produce fermented milk, and for its viability, using the methods proposed by Morandi et al. [14] and Chiu et al. [40], respectively.

The acidifying ability was assessed in skimmed milk (Merck, Germany) by measuring using the pH meter (Sartorius PB 21, USA) during 24 h of incubation at 37°C, and the acidification rate was calculated using the following formula:

The values of ∆pH at 6 h and 24 h were used to evaluate the acidifying ability of the strain.

The overnight bacterial culture was inoculated (2%, v/v) into skimmed milk (4%, w/v) that had been previously sterilized and cooled to room temperature. The inoculated milk was then incubated at 37°C for 24 h to allow fermentation, followed by storage at 4°C for four weeks. During the storage period, the fermented milk was examined every week for the viability of bacteria and changes in pH.

2.4.2. Growth at Different pH Values and NaCl Concentrations

The tolerance to different pH values and NaCl concentrations was tested in the MRS broths with pH ranging from 2.0 to 10.0 and in the MRS broths containing increasing concentrations of sodium chloride (1%, 2%, 3%, 4%, 5%, and 6%), respectively. The aforementioned broths were inoculated with fresh culture and incubated at 37°C for 48 h. At 24 and 48 h of incubation, absorbance was measured at 600 nm. Cultures grown in commercial MRS broth were used as a control, and experiments were performed in triplicate independently.

2.5. Statistical Analysis

All statistical analyses were performed using the SPSS program (version 17, SPSS Inc., Chicago, IL, USA). Means and standard deviations were calculated, and significant differences were determined using ANOVA at the probability level of . The mean differences were compared using Tukey’s test.

3. Results

3.1. Isolation and Identification of E. lactis PMD74 Strain

A total of 114 colonies exhibiting the typical morphology of Enterococcus on KAA agar were transferred onto BHI Agar. It was determined that eighty-four colonies exhibited inhibition zones larger than 10 mm against the indicator strains (results not shown). Among these colonies, PMD74 was selected for further experiments as it exhibited the highest antimicrobial activity. The characteristic properties (Gram-positive, catalase-negative and aesculin-positive, coccus-shaped isolate that was able to grow effectively at 10–45°C, pH 9.6, and in the presence of both NaCl and bile salts) of the strain were consistent with the general characteristics of genus Enterococcus [17]. According to the results of the API 20 Strep test, the isolate was observed to generate a positive reaction for Voges–Proskauer, pyrrolidonyl arylamidase, and leucine aminopeptidase, while it was negative for α-galactosidase, β-glucuronidase, and hippurate. Additionally, the strain possessed the ability to produce acid from arabinose, lactose, L-mannitol, ribose, and trehalose, while acid production from glycogen, inulin, raffinose, and sorbitol was observed. The strain possessed weak acid production ability from starch. The finding that the PMD74 strain did not produce gas from sucrose, while it produced gas from salicin, also supported the proposition that PMD74 was a different strain than E. hirae [17].

According to the complete 16S rRNA gene sequence analysis, which was performed in order to ensure molecular identification, the isolate was designated as an Enterococcus lactis strain. E. lactis PMD74 was deposited in the NCBI GenBank database under the accession number MK318965–66.

3.2. In Vitro Evaluation of Probiotic Properties
3.2.1. Survival under Conditions Simulating Human GI Tract

In the present study, survival of E. lactis PMD74 was evaluated in both gastric and intestinal juices. Resistance to pH 2 and pepsin (at pH 2) was observed only with the lower counts (<2 log CFU·mL−1) in the initial time points of the treatment (data not shown). However, the viable counts in PBS with pepsin and in PBS without pepsin, both adjusted to pH 3, remained almost unaltered, after three hours of treatment. The results demonstrated that E. lactis PMD74 was able to survive at all the concentrations of the bile salts tested and exhibited an exponential growth during the 4 h of incubation after inoculation. No significant differences were observed between the control and treatments with different concentrations of bile salts. However, treatment with pancreatin (pH 8) resulted in a 2 log loss in the cell viability compared to control (Table 4).


Time (min)E. lactis PMD74

Simulated gastric juice control
pH 3608.63 ± 0.17a
1208.64 ± 0.08a
1808.73 ± 0.07a
608.73 ± 0.08a
1208.34 ± 0.09a
1808.53 ± 0.03a
Pepsin (3 mg·mL−1, pH 3)607.80 ± 0.21a
1207.50 ± 0.11a
1807.50 ± 0.05a

Simulated intestinal juice control
Bile salt (0.3%)608.64 ± 0.08a
2408.50 ± 0.06a
608.50 ± 0.19a
2408.30 ± 0.02a
Bile salt (0.5%)608.56 ± 0.11a
2407.11 ± 0.01a
Pancreatin (1 mg·mL−1, pH 8.0)606.60 ± 0.16a
2406.47 ± 0.08a

Simulated digestion system control
08.90 ± 0.05a
2408.87 ± 0.07a
Oral cavity59.04 ± 0.03a
Gastric digestion907.70 ± 0.12a
Intestinal digestion1506.85 ± 0.08a

± indicates standard deviation of three replicates. The values with the same letter (a) are not statistically significant .
3.2.2. Bile Salt Hydrolysis

PMD74 was observed to exhibit partial bile salt hydrolase activity, which was recorded as differentiated colony morphology on the TDCA-MRS agar in comparison to the control MRS agar plates (Table 5). No significant difference was observed among the independent experiments .


E. lactis PMD74

BSH activity+
Mucin degradation activity
Gelatinase activity
Autoaggregation (%)
T411 ± 0.98
T2033 ± 1.00
T2441 ± 1.00
Coaggregation (%)
Salm. enterica serotype Typhimurium SL134423% ± 2.00
S. aureus ATCC 653810.3% ± 1.70
E. coli ATCC 269227.4% ± 0.59
Hemolytic activityγ-Hemolytic
Amino acid decarboxylase detection
 Histidine decarboxylase
 Tyrosine decarboxylase
 Ornithine decarboxylase
 Arginine decarboxylase+
Acidification activity
 ∆pH60.8 ± 0.09
 ∆pH241.38 ± 0.09

± indicates standard deviation of three replicates. The result is expressed as the percentage (%) of coaggregated bacteria with the tested foodborne pathogens after 4 h incubation at 20°C.
3.2.3. Determination of Cell Surface Characteristics

The strain PMD74 exhibited considerable autoaggregation characteristic, which increased as a function of time and was at its highest (41%) at the time point of 24 h. The strain also demonstrated great coaggregative properties with all the tested foodborne pathogens after 4 h of incubation at 20°C and exhibited the highest coaggregation percentage of 23% with S. enterica serotype Typhimurium SL1344, followed by 10.3% with S. aureus ATCC 6538 and 7.4% with E. coli ATCC 26922 (Table 5).

3.2.4. Evaluation of Antimicrobial Activity

The antimicrobial activity of the strain E. lactis PMD74 against fifteen Gram (+) and Gram (−) indicator strains was screened by using the agar spot assay and well diffusion method. In the agar spot assay, a broad antimicrobial activity spectrum, as presented in Table 1, was determined against certain bacteria including the Gram (−) bacteria . Neutralized CFS of E. lactis PMD74 exhibited antimicrobial activities against closely related as well as against unrelated Gram (+) bacteria. It was noteworthy that the highest activity of the neutralized CFS was detected against L. monocytogenes ATCC 7644. The antimicrobial activity against Lb. plantarum LMG2003, B. longum CHL28, and S. enterica serotype Typhimurium SL1344 observed in the agar spot assay could not be determined with the well diffusion assay. The treatment of neutralized CFS of E. lactis PMD74 against E. faecalis ATCC 29212 with proteinase-K and trypsin resulted in a complete loss of the antimicrobial activity. However, no alteration in the antimicrobial activity was observed with catalase treatment (data not shown). The antimicrobial activity of this proteinaceous substance was estimated to be 6400 AU/mL.

3.3. Safety Assessment
3.3.1. Antibiotic Susceptibility and Hemolytic and Mucin Degradation Activity

The results of the antibiotic susceptibility test for E. lactis PMD74 are summarized in Table 3. E. lactis PMD74 exhibited susceptibility to all cell wall synthesis inhibitors tested in the present study. The strain was also observed to be susceptible to the protein synthesis inhibitors, such as gentamicin, tetracycline, chloramphenicol, and tylosin as well as to the nucleic acid synthesis inhibitors. It exhibited intermediate sensitivity to erythromycin, while resistance to the antibiotics such as kanamycin, streptomycin, and clindamycin.

The strain E. lactis PMD74 did not show mucin degradation activity and exhibited γ-hemolysis after 48 h of incubation on blood agar plates (Table 5).

3.3.2. Screening for the Presence of Virulence Genes

In order to evaluate the potential pathogenicity of the E. lactis PMD74 strain, the presence of genes encoding the enterococcal surface protein (esp), adhesion of collagen (ace), serine protease (sprE), and gelatinase (gelE) was tested using the PCR method (Figure 1). Among the four genes tested for, E. lactis PMD74 was observed to be positive for three virulence determinants, ace, sprE, and gelE, and negative for esp.

3.3.3. Amino Acid Decarboxylase Detection

Arginine decarboxylase activity was detected positive for the strain E. lactis PMD74 and negative for the amino acids histidine, tyrosine, and ornithine (Table 5). No significant difference was observed among the independent experiments .

3.4. Technological Properties

The values of ∆pH for E. lactis PMD74 at 6 h (∆pH6) and 24 h (∆pH24), which highlighted the acidifying behavior of the strain, are listed in Table 5.

No decrease in the viable counts of the strain E. lactis PMD74 was observed during the four-week-long storage at 4°C. Although the viable cell counts remained almost consistent (ranging between 8.54 and 8.86 Log CFU·mL−1), a gradual decrease in the pH was observed after fermentation, which reached the value of 4.77 at the end of the fourth week (Figure 2). The results for tolerance to different pH values and NaCl concentrations are presented in Figure 3. At pH below 5.0, growth was much slower in the MRS medium compared to the control strain, and it decreased inversely with the increasing concentration of salt.

4. Discussion

The presence of enterococci during the ripening period of the cheese develops the flavor and the specific physicochemical properties of the different varieties of cheese as a result of the proteolytic and lipolytic activities of these bacteria [3]. Previous studies have reported the common presence of enterococcal strains, such as E. faecium, E. faecalis, E. durans, E. gallinarum, and E. italicus, in Turkish white cheese as a result of contamination from several sources, including poor hygienic conditions [41, 42]. Ezine cheese, Turkish white cheese, contains large biodiversity of spontaneous LAB microbiota and constitutes a source of the isolation for novel strains. To the best of our knowledge, this study is the pioneer in reporting the isolation and identification of E. lactis from dairy products in Turkey.

The properties, which are recommended by FAO/WHO [10], of the selection for a strain as a desirable probiotic microorganism are as follows: survival in the GI tract, bile tolerance, bile salt deconjugation, aggregation, and the ability to produce antimicrobial agents against the potential pathogenic bacteria. The primary requirement of a bacterium to be regarded as a probiotic is to survive in high acidic environment in the stomach and in high concentration of bile components in the proximal intestine of the host. The range of pH in the stomach is between 2.5 and 3.5, except during prolonged fasting when it is 1.5 or after a meal when it is 4.5 [43, 44]. The resistance of E. lactis PMD74 to simulated gastric juice, bile salts, and pancreatin is parallel to the resistances of E. italicus, E. faecium, E. durans, and E. lactis strains in the studies of Fortina et al. [45], Ahmadova et al. [5], Pieniz et al. [46], Morandi et al. [14], and Braïek et al. [9], respectively.

The BSH activity, which has been correlated with cholesterol-lowering effect, is an essential criterion for selection of a strain as probiotic [9]. The positive BSH activity exhibited by E. lactis PMD74 and the substantial tolerance to bile salt cause this strain to be a probiotic candidate [8, 9].

Both autoaggregation and coaggregation abilities are considered advantageous properties for the probiotics [7]. In detail, the autoaggregation capacity provides the probiotic strains with the ability to adhere to and colonize the intestinal mucosa. Furthermore, the ability to coaggregate with pathogens is considered important for the host defense mechanism of colonization of the pathogenic bacteria, due to a reduction in the cell-cell distances between the probiotic and the pathogens, which increases the efficiency of the antimicrobial metabolites (organic acids, bacteriocins, etc.) [47]. Autoaggregation rates for different species belonging to genus Enterococcus have been reported previously by Ahmadova et al. [5] and Fortina et al. [45]. The autoaggregation rates obtained in the present study for E. lactis PMD74 were observed to be higher than those reported for E. lactis strains in two previous studies conducted by Braïek et al. [8, 9], in which the rates were in the range of 16%–31% and 20%–36%, respectively. The results of the coaggregation tests were in line with the results reported by Ahmadova et al. [5] and Braïek et al. [8, 9].

Bacteriocin production is another expected property of the probiotic bacteria as it enhances the resistance of them against the resident intestinal flora [48]. In this context, it was observed that E. lactis PMD74 inhibited the growth of closely related Gram (+) bacteria as well as the pathogen strains such as L. monocytogenes ATCC 7644 and S. aureus ATCC 6538 at varying levels. Similar spectra of inhibitory activities by different enterococcal strains, including E. lactis, have been reported by previous studies as well [3, 5, 8, 9, 42]. The high antilisterial effect observed for the tested strain PMD74 was remarkable and in line with the studies reported previously by Ahmadova et al. [5]. However, observed activity against L. monocytogenes in this study was higher than that reported in the studies by Braïek et al. [8, 9]. Interestingly, antimicrobial activity against the tested E. coli strains was detected in the present study [8, 9, 42, 49]. However, it has been reported in a few studies that the activity against Gram-negative bacteria is rare [5]. Proteinase-K and trypsin treatments of the neutralized CFS resulted in the loss of antimicrobial activity and showed the bacteriocin-producing potential of E. lactis PMD74.

The determinations of antibiotic susceptibility and hemolytic activity are considered as safety aspect for the selection of probiotic strains [10]. The strain PMD74 was observed to be susceptible to the clinically most relevant antibiotics for curing infections. On the other hand, the observed kanamycin resistance reflects the natural resistance of the Enterococcus spp. Similar results have been reported previously for E. faecium strains [50] and E. lactis strains [8, 9, 14, 19]. As a safety concern, the sensitivity of the novel strains against the commonly used antibiotics is desirable [3]. Although antibiotic-resistant enterococci may be isolated from foods, only a few are resistant to clinically important antibiotics such as ampicillin, penicillin, gentamicin, and vancomycin [1, 51]. The result of the hemolytic activity assessment was in line with the results reported by Pieniz et al. [46] on various species belonging to genus Enterococcus (E. faecium, E. faecalis, E. casseliflavus, E. durans, E. gallinarum, and E. hirae) isolated from different sources.

The virulence potential of enterococci requires proper characterization of the wild strains in order to verify their adequacy to be used as probiotics. In the present study, it was determined that E. lactis PMD74 did not possess genes coding for esp, which is one of the adhesion-associated proteins, although it did possess the ace gene. The results of the present study were consistent with the results reported by Morandi et al. [14] and Braïek et al. [8, 9] for E. lactis. The E. lactis PMD74 strain was observed to be positive for another pathogenicity factor coded by the gelE gene, which is associated with gelatinase activity. This result was in accordance with the previous observations for both E. durans and E. faecalis [7, 42], and in contrast with the observations reported for E. lactis by Morandi et al. [14]. On the basis of results of the studies conducted by Carlos et al. [52], Nueno-Palop and Narbad [7] suggested that the identification of the presence of virulence genes using PCR does not imply that the gene is functional. The aforementioned studies indicated that the expression of the virulence genes is dependent on the strain and the environmental factors. However, consistent with our results, Eaton and Gasson [24] demonstrated that even when a virulence gene such as gelE is present, it may be silent in the phenotype. On the other side, the expression of the collagen adhesion protein coded by ace may confer the ability to adhere to and colonize the eukaryotic cells. The presence of this gene was also revealed in the probiotic strain E. faecalis Symbioflor 1, and the gene was interpreted as a probiotic factor that promotes colonization of and persistence in the gastrointestinal tract, rather than a true virulence determinate [53].

Although amino acid decarboxylations are important reactions for sensory changes in fermented foods, from a food safety standpoint, both of these reactions may also lead to the formation of biogenic amines [54]. The production of biogenic amines has traditionally been considered a species-level rather than a strain-level characteristic. The three species of the genus Enterococcus (E. faecium, E. faecalis, and E. durans), which are commonly isolated from dairy products, have been identified and reported as tyramine or putrescine producers [3]. The presence of these biogenic amines is considered an obstacle for the possible use of Enterococcus as a starter and/or protective culture in fermented foods with long ripening phase, especially the ones in which strong proteolysis occurs [55]. Nonetheless, this ability must not be disregarded when the enterococcal strains are being proposed as probiotics. The fact remains that a quantitative evaluation of biogenic amines rather than a qualitative one has to be used as a criterion for the selection of enterococci. However, the results of the present study indicated that E. lactis PMD74 was safe to be used as a probiotic in terms of biogenic amine production.

When the technological properties of E. lactis PMD74 were evaluated, remarkable results were achieved. According to Psoni et al. [56], E. lactis PMD74 was classified as a low acidifier as it caused a decrease in the pH lower than 1.5 pH units. Generally, enterococci are classified as poor milk acidifiers. The poor acidifying capacity of the dairy-originated E. lactis and E. faecium strains have also been reported by Morandi et al. [18] and Favaro et al. [50]. This finding of the present study suggested the possible application of E. lactis PMD74 as an adjunct culture rather than a starter culture. It has been stated in the legal requirements that the number of viable cells should be higher than 6 log CFU·mL−1 in order to exhibit health benefits in probiotic products [10]. E. lactis PMD74 exhibited considerable survival ability (8.86 Log CFU·mL−1) for the complete storage period of four weeks when compared with the results reported by Yerlikaya et al. [57]. In order to evaluate the suitability of the candidate probiotic strain for the technological process, its physiological traits were studied. Since the strain was isolated from cheese and exhibited the general characteristics of the genus Enterococcus, the revelation of tolerance to both pH and NaCl was not surprising. The detected technological properties of the isolate suggested that this isolate could be suitable for application in the food industry.

5. Conclusion

In conclusion, the present study revealed that Ezine cheese (PDO), which is a nonstarter, long-ripened Turkish white cheese, serves as a source for the isolation of novel enterococcal strains. To the best of our knowledge, this is the first study on the isolation of E. lactis in Turkey. The results such as high resistance of the strain to the GI tract simulated conditions, other physiological characteristics, and notable antimicrobial activity to both close relative and foodborne pathogenic bacteria render E. lactis PMD74 a probiotic candidate. Given the fact that probiotic microorganisms should remain alive and effective during consumption and administration, the E. lactis PMD 74 strain exhibited notable survival ability in fermented milk during the four-week-long storage. Therefore, it is proposed that this novel strain E. lactis PMD74 might have a probiotic potential. For recommendation as candidate probiotic strain, further investigations including in vitro and in vivo studies must be conducted in order to elucidate the safety of this strain and its potential application in dairy fermented foods.

Data Availability

The data used to support the findings of this study are included within the article.

Conflicts of Interest

The author declares that there are no conflicts of interest.

Acknowledgments

The author expresses her gratitude to Yurtsev Uymaz, Mustafa Akçelik, Nefise Akçelik, and Pınar Şanlıbaba for their kind help.

References

  1. J. Ogier and P. Serror, “Safety assessment of dairy microorganisms: the Enterococcus genus,” International Journal of Food Microbiology, vol. 126, no. 3, pp. 291–301, 2008. View at: Publisher Site | Google Scholar
  2. LPSN, “List of prokaryotic names with standing in nomenclature: genus Enterococcus.” 2018, http://www.bacterio.net/enterococcus.html.
  3. G. Giraffa, “Functionality of enterococci in dairy products,” International Journal of Food Microbiology, vol. 88, no. 2-3, pp. 215–222, 2003. View at: Publisher Site | Google Scholar
  4. C. M. A. P. Franz, M. Huch, H. Abriouel, W. Holzapfel, and A. Gálvez, “Enterococci as probiotics and their implications in food safety,” International Journal of Food Microbiology, vol. 151, no. 2, pp. 125–140, 2011. View at: Publisher Site | Google Scholar
  5. A. Ahmadova, S. D. Todorov, Y. Choiset et al., “Evaluation of antimicrobial activity, probiotic properties and safety of wild strain Enterococcus faecium AQ71 isolated from Azerbaijani Motal cheese,” Food Control, vol. 30, no. 2, pp. 631–641, 2013. View at: Publisher Site | Google Scholar
  6. O. B. Braïek, H. Ghomrassi, P. Cremonesi et al., “Isolation and characterisation of an enterocin P-producing Enterococcus lactis strain from a fresh shrimp (Penaeus vannamei),” Antonie van Leeuwenhoek, vol. 110, no. 6, pp. 771–786, 2017. View at: Publisher Site | Google Scholar
  7. C. Nueno-Palop and A. Narbad, “Probiotic assessment of Enterococcus faecalis CP58 isolated from human gut,” International Journal of Food Microbiology, vol. 145, no. 2-3, pp. 390–394, 2011. View at: Publisher Site | Google Scholar
  8. O. B. Braïek, S. Morandi, P. Cremonesi, S. Smaoui, K. Hani, and T. Ghrairi, “Safety, potential biotechnological and probiotic properties of bacteriocinogenic Enterococcus lactis strains isolated from raw shrimps,” Microbial Pathogenesis, vol. 117, pp. 109–117, 2018. View at: Publisher Site | Google Scholar
  9. O. B. Braïek, S. Morandi, P. Cremonesi, S. Smaoui, K. Hani, and T. Ghrairi, “Biotechnological potential, probiotic and safety properties of newly isolated enterocin-producing Enterococcus lactis strains,” LWT, vol. 92, pp. 361–370, 2018. View at: Publisher Site | Google Scholar
  10. FAO/WHO, Joint FAO/WHO Working Group Report Drafting Guidelines for the Evaluation of Probiotics in Food, FAO/WHO, London, Canada, 2002.
  11. M. R. Foulquié Moreno, R. Callewaert, B. Devreese, J. Van Beeumen, and L. De Vuyst, “Isolation and biochemical characterisation of enterocins produced by enterococci from different sources,” Journal of Applied Microbiology, vol. 94, no. 2, pp. 214–229, 2006. View at: Publisher Site | Google Scholar
  12. K. Koutsoumanis, A. Allende, A. Álvarez-Ordóñez et al., “Update of the list of QPS‐recommended biological agents intentionally added to food or feed as notified to EFSA 9: suitability of taxonomic units notified to EFSA until September 2018,” EFSA Journal, vol. 17, no. 1, Article ID e05555, 2019. View at: Publisher Site | Google Scholar
  13. T. O’Driscoll and C. W. Crank, “Vancomycin-resistant enterococcal infections: epidemiology, clinical manifestations, and optimal management,” Infection and Drug Resistance, vol. 2015, no. 8, pp. 217–230, 2015. View at: Publisher Site | Google Scholar
  14. S. Morandi, T. Silvetti, and M. Brasca, “Biotechnological and safety characterization of Enterococcus lactis, a recently described species of dairy origin,” Antonie van Leeuwenhoek, vol. 103, no. 1, pp. 239–249, 2013. View at: Publisher Site | Google Scholar
  15. S. G. Botina and V. V. Sukhodolets, “Speciation in bacteria: comparison of the 16S rRNA gene for closely related Enterococcus species,” Russian Journal of Genetics, vol. 42, no. 3, pp. 247–251, 2006. View at: Publisher Site | Google Scholar
  16. R. Bauer, J. P. Bekker, N. V. Wyk, C. du Toit, L. M. T. Dicks, and J. Kossmann, “Exopolysaccharide production by lactose-hydrolyzing bacteria isolated from traditionally fermented milk,” International Journal of Food Microbiology, vol. 131, no. 2-3, pp. 260–264, 2009. View at: Publisher Site | Google Scholar
  17. S. Morandi, P. Cremonesi, M. Povolo, and M. Brasca, “Enterococcus lactis sp. nov., from Italian raw milk cheeses,” International Journal of Systematic and Evolutionary Microbiology, vol. 62, no. 8, pp. 1992–1996, 2012. View at: Publisher Site | Google Scholar
  18. S. Morandi, M. Brasca, and R. Lodi, “Technological, phenotypic and genotypic characterisation of wild lactic acid bacteria involved in the production of Bitto PDO Italian cheese,” Dairy Science & Technology, vol. 91, no. 3, pp. 341–359, 2011. View at: Publisher Site | Google Scholar
  19. O. B. Braïek, P. Cremonesi, S. Morandi, S. Smaoui, K. Hani, and T. Ghrairi, “Safety characterisation and inhibition of fungi and bacteria by a novel multiple enterocin-producing Enterococcus lactis 4CP3 strain,” Microbial Pathogenesis, vol. 118, pp. 32–38, 2018. View at: Publisher Site | Google Scholar
  20. Anonymous, The Geographical Indication of Goods, Ezine Cheese, Certificate of Registry, No: 86, Turkish Patent and Trademark Office, Ankara, Turkey, 2006.
  21. U. Schillinger and F. K. Lücke, “Antibacterial activity of Lactobacillus sake isolated from meat,” Applied and Environmental Microbiology, vol. 55, no. 8, pp. 1901–1906, 1989. View at: Google Scholar
  22. M. R. Cancilla, I. B. Powell, A. J. Hillier, and B. E. Davidson, “Rapid genomic fingerprinting of Lactococcus lactis strains by arbitrarily primed polymerase chain reaction with 32P and fluorescent labels,” Applied Environmental Microbiology, vol. 58, no. 5, pp. 1772–1775, 1992. View at: Google Scholar
  23. S. S. Beasley and P. E. J. Saris, “Nisin-producing lactococcus lactis strains isolated from human milk,” Applied and Environmental Microbiology, vol. 70, no. 8, pp. 5051–5053, 2004. View at: Publisher Site | Google Scholar
  24. T. J. Eaton and M. J. Gasson, “Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates,” Applied and Environmental Microbiology, vol. 67, no. 4, pp. 1628–1635, 2001. View at: Publisher Site | Google Scholar
  25. N. B. Omar, A. Castro, R. Lucas et al., “Functional and safety aspects of enterococci isolated from different Spanish foods,” Systematic and Applied Microbiology, vol. 27, no. 1, pp. 118–130, 2004. View at: Publisher Site | Google Scholar
  26. J. Nakayama, R. Kariyama, and H. Kumon, “Description of a 23.9-kilobase chromosomal deletion containing a region encoding fsr genes which mainly determines the gelatinase-negative phenotype of clinical isolates of Enterococcus faecalis in urine,” Applied and Environmental Microbiology, vol. 68, no. 6, pp. 3152–3155, 2002. View at: Publisher Site | Google Scholar
  27. P. L. Conway, S. L. Gorbach, and B. R. Goldin, “Survival of lactic acid bacteria in the human stomach and adhesion to intestinal cells,” Journal of Dairy Science, vol. 70, no. 1, pp. 1–12, 1987. View at: Publisher Site | Google Scholar
  28. B. Uymaz, Ö. Şimşek, N. Akkoç, H. Ataoğlu, and M. Akçelik, “In vitro characterization of probiotic properties of Pediococcus pentosaceus BH105 isolated from human faeces,” Annals of Microbiology, vol. 59, no. 3, pp. 485–491, 2009. View at: Publisher Site | Google Scholar
  29. M. G. Vizoso Pinto, C. M. A. P. Franz, U. Schillinger, and W. H. Holzapfel, “Lactobacillus spp. with in vitro probiotic properties from human faeces and traditional fermented products,” International Journal of Food Microbiology, vol. 109, no. 3, pp. 205–214, 2006. View at: Publisher Site | Google Scholar
  30. P. A. Maragkoudakis, G. Zoumpopoulou, C. Miaris, G. Kalantzopoulos, B. Pot, and E. Tsakalidou, “Probiotic potential of Lactobacillus strains isolated from dairy products,” International Dairy Journal, vol. 16, no. 3, pp. 189–199, 2006. View at: Publisher Site | Google Scholar
  31. J. S. Zhou, P. K. Gopal, and H. S. Gill, “Potential probiotic lactic acid bacteria Lactobacillus rhamnosus (HN001), Lactobacillus acidophilus (HN017) and Bifidobacterium lactis (HN019) do not degrade gastric mucin in vitro,” International Journal of Food Microbiology, vol. 63, no. 1-2, pp. 81–90, 2001. View at: Publisher Site | Google Scholar
  32. M. C. Collado, J. Meriluoto, and S. Salminen, “Adhesion and aggregation properties of probiotic and pathogen strains,” European Food Research and Technology, vol. 226, no. 5, pp. 1065–1073, 2008. View at: Publisher Site | Google Scholar
  33. M. J. van Belkum, B. J. Hayema, A. Geis, J. Kok, and G. Venema, “Cloning of two bacteriocin genes from a lactococcal bacteriocin plasmid,” Applied and Environmental Microbiology, vol. 55, no. 5, pp. 1187–1191, 1989. View at: Google Scholar
  34. J. R. Tagg and A. R. Mcgiven, “Assay systems for bacteriocins,” Applied and Environmental Microbiology, vol. 21, no. 5, pp. 943–947, 1971. View at: Google Scholar
  35. H. Daba, C. Lacroix, J. Huang, and R. E. Simard, “Influence of growth conditions on production and activity of a bacteriocin produced by Leuconostoc mesenteroides,” Applied and Environmental Microbiology, vol. 57, pp. 3450–3455, 1993. View at: Google Scholar
  36. W. P. Charteris, P. M. Kelly, L. Morelli, and J. K. Collins, “Development and application of an in vitro methodology to determine the transit tolerance of potentially probiotic Lactobacillus and Bifidobacterium species in the upper human gastrointestinal tract,” Journal of Applied Microbiology, vol. 84, no. 5, pp. 759–768, 1998. View at: Publisher Site | Google Scholar
  37. G. Rychen, G. Aquilina, G. Azimonti et al., “Guidance on the characterization of microorganisms used as feed additives or as production organisms,” EFSA Journal, vol. 16, no. 3, Article ID e05206, 2018. View at: Publisher Site | Google Scholar
  38. Clinical and Laboratory Standards Institute (CLSI), Performance Standards for Antimicrobial Susceptibility Testing, Twenty-Second Informational Supplement, CLSI Document M100-MS19. CLSI, Wayne, PA, USA, 27th edition, 2012.
  39. R. L. Maijala, “Formation of histamine and tyramine by some lactic acid bacteria in MRS-broth and modified decarboxylation agar,” Letters in Applied Microbiology, vol. 17, no. 1, pp. 40–43, 1993. View at: Publisher Site | Google Scholar
  40. C.-H. Chiu, T.-Y. Lu, Y.-Y. Tseng, and T.-M. Pan, “The effects of Lactobacillus-fermented milk on lipid metabolism in hamsters fed on high-cholesterol diet,” Applied Microbiology and Biotechnology, vol. 71, no. 2, pp. 238–245, 2006. View at: Publisher Site | Google Scholar
  41. R. Hajikhani, Y. Beyatli, and B. Aslim, “Antimicrobial activity of enterococci strains isolated from white cheese,” International Journal of Dairy Technology, vol. 60, no. 2, pp. 105–108, 2007. View at: Publisher Site | Google Scholar
  42. H. İspirli, F. Demirbaş, and E. Dertli, “Characterization of functional properties of Enterococcus spp. isolated from Turkish white cheese,” LWT, vol. 75, pp. 358–365, 2017. View at: Publisher Site | Google Scholar
  43. B. Hyronimus, C. Le Marrec, A. Hadj Sassi, and A. Deschamps, “Acid and bile tolerance of spore-forming lactic acid bacteria,” International Journal of Food Microbiology, vol. 61, no. 2-3, pp. 193–197, 2000. View at: Publisher Site | Google Scholar
  44. A. R. Madureira, C. I. Pereira, K. Truszkowska, A. M. Gomes, M. E. Pintado, and F. X. Malcata, “Survival of probiotic bacteria in a whey cheese vector submitted to environmental conditions prevailing in the gastrointestinal tract,” International Dairy Journal, vol. 15, no. 6–9, pp. 921–927, 2005. View at: Publisher Site | Google Scholar
  45. M. G. Fortina, G. Ricci, F. Borgo et al., “A survey on biotechnological potential and safety of the novel Enterococcus species of dairy origin, E. italicus,” International Journal of Food Microbiology, vol. 123, no. 3, pp. 204–211, 2008. View at: Publisher Site | Google Scholar
  46. S. Pieniz, R. Andreazza, T. Anghinoni, F. Camargo, and A. Brandelli, “Probiotic potential, antimicrobial and antioxidant activities of Enterococcus durans strain LAB18s,” Food Control, vol. 37, pp. 251–256, 2014. View at: Publisher Site | Google Scholar
  47. R. Tareb, M. Bernardeau, M. Gueguen, and J.-P. Vernoux, “In vitro characterization of aggregation and adhesion properties of viable and heat-killed forms of two probiotic Lactobacillus strains and interaction with foodborne zoonotic bacteria, especially Campylobacter jejuni,” Journal of Medical Microbiology, vol. 62, no. 4, pp. 637–649, 2013. View at: Publisher Site | Google Scholar
  48. B. Uymaz, N. Akkoç, and M. Akçelik, “Partial characterization of bacteriocins produced by twoLactobacilusstrains with probiotic properties,” Acta Biologica Hungarica, vol. 62, no. 1, pp. 95–105, 2011. View at: Publisher Site | Google Scholar
  49. J. E. Line, E. A. Svetoch, B. V. Eruslanov et al., “Isolation and purification of enterocin E-760 with broad antimicrobial activity against gram-positive and gram-negative bacteria,” Antimicrobial Agents and Chemotherapy, vol. 52, no. 3, pp. 1094–1100, 2008. View at: Publisher Site | Google Scholar
  50. L. Favaro, M. Basaglia, S. Casella et al., “Bacteriocinogenic potential and safety evaluation of non-starter Enterococcus faecium strains isolated from home made white brine cheese,” Food Microbiology, vol. 38, pp. 228–239, 2014. View at: Publisher Site | Google Scholar
  51. A. C. Majhenic, I. Rogelj, and B. Perko, “Enterococci from Tolminc cheese: population structure, antibiotic susceptibility and incidence of virulence determinants,” International Journal of Food Microbiology, vol. 102, no. 2, pp. 239–244, 2005. View at: Publisher Site | Google Scholar
  52. A. R. Carlos, T. Semedo-Lemsaddek, M. T. Barreto-Crespo, and R. Tenreiro, “Transcriptional analysis of virulence-related genes in enterococci from distinct origins,” Journal of Applied Microbiology, vol. 108, no. 5, pp. 1563–1575, 2010. View at: Publisher Site | Google Scholar
  53. E. Domann, T. Hain, R. Ghai et al., “Comparative genomic analysis for the presence of potential enterococcal virulence factors in the probiotic Enterococcus faecalis strain Symbioflor 1,” International Journal of Medical Microbiology, vol. 297, no. 7-8, pp. 533–539, 2007. View at: Publisher Site | Google Scholar
  54. F. A. Zuljan, P. Mortera, S. H. Alarcón, V. S. Blancato, M. Espariz, and C. Magni, “Lactic acid bacteria decarboxylation reactions in cheese,” International Dairy Journal, vol. 62, pp. 53–62, 2016. View at: Publisher Site | Google Scholar
  55. EFSA Panel on Biological Hazards (BIOHAZ), “Scientific opinion on risk-based control of biogenic amine formation in fermented foods,” EFSA Journal, vol. 9, no. 10, p. 2393, 2011. View at: Publisher Site | Google Scholar
  56. L. Psoni, C. Kotzamanidis, M. Yiangou, N. Tzanetakis, and E. Litopoulou-Tzanetaki, “Genotypic and phenotypic diversity of Lactococcus lactis isolates from Batzos, a Greek PDO raw goat milk cheese,” International Journal of Food Microbiology, vol. 114, no. 2, pp. 211–220, 2007. View at: Publisher Site | Google Scholar
  57. O. Yerlikaya, G. Gulsah Ender, F. A. Torunoglu, and N. Akbulut, “Production of probiotic milk drink containing Lactobacillus acidophilus, Bifidobacterium animalis subsp. lactis and Lactobacillus casei,” Agro Food Industry Hi-Tech, vol. 24, no. 2, pp. 49–52, 2013. View at: Google Scholar

Copyright © 2019 Başar Uymaz Tezel. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views1199
Downloads413
Citations

Related articles

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.