Journal of Immunology Research / 2014 / Article / Tab 1

Research Article

Effects of Pristane Alone or Combined with Chloroquine on Macrophage Activation, Oxidative Stress, and Th1/Th2 Skewness

Table 1

Primers for real-time quantitative RT-PCR analysis.

GeneForward sequence (5′ to 3′)Reverse sequence (5′ to 3′)

T-betAGCAAGGACGGCGAATGTTGTGGACATATAAGCGGTTCCC
IL-12p35CACCCTTGCCCTCCTAAACCCACCTGGCAGGTCCAGAGA
GATA-3AGAGGTATCCTCCGACCCACATGAAGCCGGAGGGTAAACG
IL-4ACTTGAGAGAGATCATCGGCAAGCTCCATGAGAACACTAGAGTT
GAPDHAGGTCGGTGTGAACGGATTTGTGTAGACCATGTAGTTGA GGTCA

IL-12, IL-4: interleukin-12, interleukin-4; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.