Research Article

Efficacy of Primate Humoral Passive Transfer in a Murine Model of Pneumonic Plague Is Mouse Strain-Dependent

Table 1

Genetic primer targets of the PCR test used to ensure integrity of the inoculum. All primer probe design was based on GenBank accession number NC_003143 (Yersinia pestis CO92, complete genome). MGB is minor groove binder/nonfluorescent quencher covalently bound to the 3′ end of the probe. All probes have a 5′ fluorescein (FAM) label.

GeneSequence (5′→3′)

HmsF (chromosomal pgm locus)
 ForwardCGGAGAAGCCAACGTTCGT
 ReverseTCTTTCACTTTGCGGCAATG
 Probe (MGB)CCGCCTGCACAACG
F1 (pMT1)
 ForwardTTGGCGGCTATAAAACAGGAA
 ReverseCACCCGCGGCATCTGTA
 Probe (MGB)CACTAGCACATCTGTTAAC
Pst (pPCP1)
 ForwardCGGCAATCGTTCCCTCAA
 ReverseGGTCAGGAAAAAGACGGTGTGA
 Probe (MGB)AACCATGACACGGTAGACT
VAg (pCD1)
 ForwardCGGCGGTTAAAGAGAAATGC
 ReverseCATCGCCGAATACACAATGG
 Probe (MGB)TACTGCCATGAACGCC