Chlorophytum borivilianum Polysaccharide Fraction Provokes the Immune Function and Disease Resistance of Labeo rohita against Aeromonas hydrophila

Table 1

Real-time primer sequences and thermocycling conditions.

Target gene	Primer sequence (5′ to 3′)	Thermocycling conditions	Reference/accession number
IL-1	ATCTTGGAGAATGTGATCGAAGAG; GATACGTTTTTGATCCTCAAGTGTGAAG	95°C 30 s, 40 cycles of 95°C 5 s, 61.5°C 30 s, and 72°C 30 s	AM932525
IL-10	AAGGAGGCCAGTGGCTCTGT; CCTGAAGAAGAGGCTCTGT	95°C 30 s, 40 cycles of 95°C 5 s, 61.1°C 30 s, and 72°C 30 s	AB010701
iNOS	GGAGGTACGTCTGCGAGGAGGCT; CCAGCGCTGCAAACCTATCATCCA	95°C 30 s, 40 cycles of 95°C 5 s, 61.1°C 30 s, and 72°C 30 s	AM932526
TNF	CCAGGCTTTCACTTCACG; GCCATAGGAATCGGAGTAG	95°C 30 s, 40 cycles of 95°C 5 s, 61.1°C 30 s, and 72°C 30 s	FN543477
TGF-	ACGCTTTATTCCCAACCAAA; GAAATCCTTGCTCTGCCTCA	95°C 30 s, 40 cycles of 95°C 5 s, 60.5°C 30 s, and 72°C 30 s	AF136947
IL-8	GGGTGTAGATCCACGCTGT; AGGGTGCAGTAGGGTCCA	95°C 30 s, 40 cycles of 95°C 5 s, 60.5°C 30 s, and 72°C 30 s	Self-design
-actin	AGACCACCTTCAACTCCATCATG; TCCGATCCAGACAGAGTATTTACGC	95°C 30 s, 40 cycles of 95°C 5 s, 60.5°C 30 s, and 72°C 30 s	[27]