Journal of Neurodegenerative Diseases / 2013 / Article / Tab 1

Research Article

Simple Repeat-Primed PCR Analysis of the Myotonic Dystrophy Type 1 Gene in a Clinical Diagnostics Environment

Table 1

Primer sequences.

Primer namePrimer sequence

P1-FAMFAM-CTTCCCAGGCCTGCAGTTTGCCCATC
P2AACGGGGCTCGAAGGGTCCTTGTAGC
P4CTGGGCGGTGGCGGCTGTTGCTGCTGCTGCTGC
P3GGCGGTGGCGGCTGTTG
P2-FAMAACGGGGCTCGAAGGGTCCTTGTAGC
P4CAGGGCGGTGGCGGCTGTTGCCAGCAGCAGCAGCAG

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.