Journal of Nanomaterials

Journal of Nanomaterials / 2019 / Article

Research Article | Open Access

Volume 2019 |Article ID 1687340 | 12 pages | https://doi.org/10.1155/2019/1687340

Gold Nanoparticles Suppressed Proliferation, Migration, and Invasion in Papillary Thyroid Carcinoma Cells via Downregulation of CCT3

Academic Editor: Michael Harris
Received22 Aug 2018
Revised25 Oct 2018
Accepted27 Nov 2018
Published06 Feb 2019

Abstract

Emerging evidences have demonstrated that gold nanoparticles (AuNPs) have been used for cancer treatment. The aim of this study was to investigate the effects and molecular mechanisms of AuNPs on papillary thyroid carcinoma (PTC) cells (BCPAP and TPC-1). Characterizations of AuNPs were detected by UV-Vis spectra, transmission electron microscopy (TEM), and dynamic light scattering (DLS). Cell proliferation and apoptosis, migration, and invasion of PTC cells were evaluated by MTT, flow cytometry, wound healing, and transwell assays, respectively. Furthermore, qRT-PCR and western blot assays were performed to assess the protein expressions related to apoptosis and migration including caspase-3, caspase-9, Bax, Bcl-2, MMP-2, and MMP-9. The study revealed that AuNPs significantly suppressed cell viability, migration, and invasion and remarkably induced apoptosis of BCPAP and TPC-1 cells compared with the control group. Moreover, AuNPs negatively regulated the expression of CCT3 and silencing of CCT3 obviously promoted the proliferation, migration, and invasion inhibition and apoptosis induction of PTC cells combined with AuNPs. Collectively, these results highlighted the potential application of AuNPs in PTC target therapy.

1. Introduction

Thyroid cancer is one of the most common endocrine malignancies with the incidence rate stably increasing over the past 10 years [1]. Papillary thyroid carcinoma (PTC) is the major histological type which accounts for approximately 80% of human thyroid cancers [2]. The prognosis of PTC has been proven to rely on several well-established clinicopathologic indicators such as age, tumor size, histologic subtype, extrathyroidal extension, and lymph node metastases [3]. In general, 10-15% of PTC patients are diagnosed with distant metastases or poor clinical effects [4]. Additionally, disease recurrence exists in 5-20% of all patients and even went through total thyroidectomy [1]. Despite the good prognosis for a majority of PTC patients, there are scarcely any effective therapeutic methods for cervical lymph node metastasis and early invasion [5]. Therefore, it is urgent to seek a novel and valid strategy for target therapy.

Metallic nanoparticles have been demonstrated as diagnostic agents or drug delivery system in cancer therapy owing to their availability, material properties, and its ability to enhance drug selectivity against cancer cells [6, 7]. Among diversified metallic nanoparticles, gold nanoparticles (AuNPs) have raised increasing interest for their distinctive properties including nanosize, less toxicity, relatively simple synthesis, and specific targeting [8, 9]. Recently, investigators have demonstated that monotherapy by AuNPs may be a promising therapeutic candidate for preventing tumor growth and metastasis [10]. AuNPs can inhibit the proliferation of ovarian tumor cells through suppressing the MAPK signaling pathway and promote leukemia cell apoptosis by inducing endoplasmic reticulum stress [11, 12]. AuNPs of 13 nm have been reported to induce inflammation and apoptosis in vivo [13]. In addition, AuNPs can affect morphological changes as well as migration and adhesion of human fibroblasts [14]. Furthermore, AuNPs have been reported to damage cancer cells through different pathways such as cell necrosis, induction of proapoptotic protein (Bax) expression, inhibition of tumor cells metastasis and migration, and suppression of oxidative reactive species production after short-time exposure [15]. However, AuNPs of 1-2 nm are reported to be cytotoxic to melanoma cells [16].

The aim of this study was to investigate the effects of tannic acid synthesized AuNPs on PTC by in vitro studies. In the present study, AuNPs were characterized for physicochemical properties including shape, size, and size distribution. And we evaluated the possible antitumor biology functions of AuNPs on PTC cells, including cell viability, apoptosis, migration, and invasion. Furthermore, we investigated the potential mechanisms by which AuNPs exerted the antitumor effects on PTC cells. Altogether, our findings may serve as a novel target for developing new strategy for papillary thyroid cancer treatment.

2. Materials and Methods

2.1. Materials

Gold (III) chloride hydrate (HAuCl4·H2O, ≥49% Au basis), tannic acid (C76H52O46), and sodium citrate (C6H5Na3O7·2H2O, ≥99%) were purchased from Sigma-Aldrich. For experiments, deionized water was used. All AuNPs were stored at darkness and filtered through a 0.1 μm polyvinylidene fluoride (PVDF) membrane before use in biological tests.

RPMI 1640 media (Sigma-Aldrich, USA) supplemented with 10% fetal bovine serum (FBS), 3-siphenyltetrazolium bromide (MTT), dimethylsulfoxide (DMSO), and trypsinase were obtained from the Biotechnology Center of Nahrain University.

2.2. Preparation of Gold Nanoparticles

AuNPs were prepared by a chemical reduction method as described [17]. Briefly, an aqueous solution of gold chloride hydrate was heated to boil point and stirred under reflux. Then, a reducing mixture of aqueous solutions of sodium citrate and tannic acid was added. AuNPs were formed when the color of the reducing mixture changed to red, and the mixture was stirred for another 15 min under reflux and cooled down to room temperature.

2.3. Characterizations of AuNPs

The size and shape of AuNPs were determined by transmission electron microscopy (TEM). The colloidal stability test was recorded at room temperature for 4 weeks, and absorption spectra of AuNPs were analyzed in the range of 400-700 nm by a UV-visible spectrophotometer (Shimadzu, Kyoto, Japan). The hydrodynamic diameter distribution was measured by dynamic light scattering (DLS) (Brookhaven Instruments Co., Holtsville, NY, USA). All tested nanoparticles were measured in triplicate.

2.4. Cell Culture

Two types of PTC cell lines (BCPAP and TPC-1 cells, Braunschweig, Germany) were used for biological effect research. Cells were cultured in RPMI 1640 supplemented with 10% fetal bovine serum (FBS) and 100 U/mL penicillin and 100 mg/mL streptomycin. All cell lines were maintained under a humidified condition with 5% CO2 at 37°C.

2.5. Cell Viability Assay

The cell viability of AuNPs was assessed by MTT assay. In brief, the two cell lines were grown in a 96-well plate and treated with 50 μg/mL AuNPs at 37°C for 24 h, 48 h, and 72 h. The cells were further incubated with MTT solution (2 mg/mL) for another 4 h. The supernatants were then flicked off and dissolved in 100 μL of DMSO. The absorbance was determined at 490 nm using a microplate reader (Epoch, Biotek).

2.6. EdU Proliferation Assay

EdU assay was conducted to detect cell proliferation using a Cell Light™ EdU kit (Ribobio). Cells were seeded in a 96-well plate and transfected for 48 h, and 50 μM of EdU was added for an additional 2 h. Then, cells were fixed with 4% formaldehyde for 30 min and incubated by 2 mg/mL glycine for 10 min. At last, cells were permeabilized by 0.5% Triton X-100 for 20 min and coincubated with DAPI. The percentage of EdU-positive cells was assessed by a fluorescence microscope.

2.7. Apoptosis Assay

To evaluate cell apoptosis, annexin V apoptosis detection kit I (BD Biosciences, USA) was employed. Simply, 50 μg/mL of AuNP-treated cells was trypsinized and suspended in 300 μL of 1x binding buffer. Then, 5 μL of annexin V-PE was added for 15 min and mixed with 5 μL 7-AAD solution for another 5 min. At last, 200 μL of 1x binding buffer was added and analyzed by a flow cytometer (BD Biosciences, USA). Here, the control cells were incubated without nanoparticle treatment.

2.8. Wound Healing Assay

Cells in the presence and absence of AuNPs were cultivated in a six-well plate until reaching single-layer confluence. Linear wounds were created using pipette tips. Then cells were washed with PBS and maintained with fresh media at 37°C for 48 h. The wound was monitored by a microscope (Nikon, Tokyo, Japan), and the gap widths were measured using ImageJ software.

2.9. Transwell Migration and Invasion Assays

The migration and invasion of BCPAP and TPC-1 cells were performed by transwell chambers (8 μm, Corning, USA) as described. For the migration assay, BCPAP and TPC-1 cells at a density of 5 × 104 cells per well were seeded into an upper chamber with serum-free medium, while the lower chamber was filled with 500 μL of medium supplemented with 20% FBS. After incubation with AuNPs for 48 h, cells on the lower surface of the membrane were fixed and stained with crystal violet. Cell migration ability was examined by counting cells under a microscope (Olympus, Tokyo, Japan) in 3 randomly selected fields.

For the invasion assay, after precoating with Matrigel (BD Biosciences, CA), BCPAP and TPC-1 cells at a density of 5 × 104 cells per well were seeded into an upper chamber with serum-free medium, while the lower chamber was filled with 500 μL of medium supplemented with 20% FBS. After incubation with AuNPs for 48 h, the cells that remained on the upper side of the membrane were removed with cotton swabs. Cells on the lower surface of the membrane were fixed and stained with crystal violet. Cell migration and invasion ability were examined by counting cells under a microscope (Olympus, Tokyo, Japan) in 3 randomly selected fields.

2.10. Packing of Lentivirus

The lentivirus vector system is constituted of the vector pGCSIL-GFP which expressed short hairpin RNA (shRNA) and green fluorescent protein (GFP), pHelper1.0 (gag/pol element), and pHelper2.0 (VSVG element). The vectors were purchased from GeneChem (Shanghai, China). The transfection assay was performed using Lipofectamine 2000 (Invitrogen). Target sequences are shown in Table 1.


shRNASequences

CCT3 shRNA5-CAAGTCCATGATCGAAATT-3
The nonsilencing control5-GCGTCCTCATACCAGGATAAA-3

2.11. Reverse Transcription Quantitative Polymerase Chain Reaction (qRT-PCR)

Total RNA was isolated and purified using TRIzol reagent (Thermo Fisher), according to the manufacturer’s instructions. Reverse transcription was performed using M-MLV reverse transcriptase (Promega Corporation, WI, USA). The mRNA level of CCT3 was conducted by qRT-PCR using SYBR Green PCR master mix (Applied Biosystems) and normalized to GAPDH. qPCR primers are shown in Table 2. qPCR data was analyzed by the ΔΔCt method.


GenesForward (5-3)Reverse (5-3)

CCT3TCAGTCGGTGGTCATCTTTGGCCTCCAGGTATCTTTTCCACTCT
GAPDHTGACTTCAACAGCGACACCCACACCCTGTTGCTGTAGCCAAA

2.12. Western Blot Analysis

For protein expression analysis, total protein was extracted according to the manufacturer’s protocol and detected using a BCA kit (Thermo Fisher Scientific). Approximately 50 μg of proteins was resolved on 10% SDS polyacrylamide gels and then transferred to PVDF membrane. After being blocked with 5% nonfat milk, the membranes were probed with primary antibodies overnight at 4°C following incubation with the secondary antibodies for 2 h at room temperature. Protein expression was examined using an enhanced chemiluminescence detection system. Antibodies used in western blot were as follows: anti-CCT3 (1 : 500; ab174255; rabbit polyclonal, Abcam), anti-rabbit IgG (catalog no. 14708; Cell Signaling Technology), MMP-2 (1 : 1,000; catalog no. 4022; Cell Signaling Technology), MMP-9 (1 : 1,000; catalog no. 3852; Cell Signaling Technology), caspase-3 (1 : 1,000; catalog no. 9662; Cell Signaling Technology), caspase-9 (1 : 1,000; catalog no. 9508; Cell Signaling Technology), Bax (1 : 1,000; catalog no. 2774; Cell Signaling Technology), Bcl-2 (1 : 1,000; catalog no. 2772; Cell Signaling Technology), and GAPDH (1 : 1,000; catalog no. 8884; Cell Signaling Technology).

2.13. Immunofluorescence

BCPAP and TPC-1 cells adhered to coverslips were treated with or without AuNPs for 24 h. Next, cells were fixed with 4% paraformaldehyde for 15 min at room temperature, stained with an anti-CCT3 primary antibody (1 : 500; Abcam), and detected with the secondary antibody (catalog no. 14708; Cell Signaling Technology). The coverslips were counter stained with 10 μL/mL DAPI and imaged with a fluorescence microscope (X51, Olympus).

2.14. Statistical Analysis

All data were performed by three-time independent experiments and expressed as the errors. Statistical analysis was calculated using GraphPad Prism 6.0 (GraphPad Software Inc., USA). Student’s -test was carried out to compare the difference between the control group and AuNP group, AuNP group, and sh-CCT3+AuNP group. A value < 0.05 was considered a significant difference.

3. Results

3.1. AuNP Characterization

Before biological assessments, AuNPs were characterized. The morphology and size of AuNPs were detected by TEM, the hydrodynamic parameters were measured with DLS technique, and the stability of AuNPs was identified by DLS and UV-Vis spectra. The TEM images, DLS data, and UV-Vis spectra of AuNPs are shown in Figures 1(a)1(c). The average size of AuNPs was 7.73 nm, and the hydrodynamic size was 9.2 ± 0.6 nm, which were accordance with previous reports [18]. The difference between the sizes measured by TEM and hydrodynamic size may be related to the shell of stabilizers adsorbed on the surface of NPs. The shells on NP surface consisted of mixtures of tannic acid and sodium citrate, which served as reducing and stabilizing agents during the biosynthesis [19]. The absorption band maxima for AuNPs was observed at 517.5 nm by UV-Vis spectra, which was attributed to surface plasmon excitation [20]. DLS results as well as UV-Vis spectra and TEM measurements confirmed high stability of AuNPs.

3.2. AuNPs Inhibited Cell Proliferation in Papillary Thyroid Carcinoma Cells

To explore the potential function of AuNPs, we firstly examined the cell proliferation by MTT and EdU assays in BCPAP and TPC-1 cells. As illustrated in Figure 2(a), when cells were treated with AuNPs at a dose of 50 μg/mL for 24 h, 48 h, and 72 h, the viability showed a time-dependent manner. The results showed that there was no significance between the control group and AuNP groups at 24 h (). After 48 h of culture, the AuNP groups had a lower proliferation rate than the control group () (Figure 2(a)). In addition, EdU assay revealed the similar results. The percentage of EdU positive cells in AuNP-treated cells was reduced (Figure 2(b)) compared to the control one. Based on these, we chose AuNPs at a dose of 50 μg/mL for 48 h for a further study [21].

3.3. AuNPs Induced Apoptosis in Papillary Thyroid Carcinoma Cells

In an attempt to investigate whether AuNPs have influence on apoptosis in BCPAP and TPC-1 cells, flow cytometry was employed. After cells were treated with 50 μg/mL AuNPs for 48 h, cells were stained with annexin V/PI. Early and late apoptosis and necrotic cells were distinguished. The quantities of total cell apoptosis in BCPAP and TPC-1 cells were 11.4% and 17.2%, whereas only 4.06% and 6.25% apoptotic cells were observed in the control groups (Figure 3(a)). We further evaluated the expression variations of apoptosis-related proteins including caspase-3, caspase-9, Bcl-2, and Bax by western blot. Our results showed that the expression of proapoptotic proteins (caspase-3, caspase-9, and Bax) was increased, while the expression of antiapoptotic protein (Bcl-2) was decreased in both BCPAP and TPC-1 cells after 48 h treatment of AuNPs (Figure 3(b)).

3.4. AuNPs Suppressed Migration and Invasion of Papillary Thyroid Carcinoma Cells

As cancer cell migration and invasion play a key role in disease progression [22], we accessed the effects of AuNPs on migration and invasion ability of BCPAP and TPC-1 cells. Wound healing and transwell assays were conducted to detect the migratory capability; as shown in Figures 4(a) and 4(b), AuNPs inhibited the migration dramatically. Compared with the control group, AuNPs decreased the wound closure rate from 85% to 70% and migratory ability from 195% to 150%. We also found that AuNPs reduced BCPAP and TPC-1 cell invasion capacities (Figure 4(b)), which was similar to the results of migration. Matrix metalloproteinases (MMPs) are recognized enzymes that digest the main proteins involved in cell motility [23]. The suppression efficacy of AuNPs on cell migration and invasion prompted us to monitor the change of MMP expressions. As illustrated in Figure 4(c), the protein levels of MMP-2 and MMP-9 were also decreased after AuNP treatment. Collectively, these results suggested that AuNPs inhibited migration and invasion of PTC cells by decreasing the expressions of MMP-2 and MMP-9.

3.5. AuNPs Downregulated CCT3 in Human Papillary Thyroid Carcinoma Cells

CCT3 plays a central role in maintaining cellular proteostasis as one of the subunits of molecular chaperone CCT/TRiC complex [24]. Accumulated studies demonstrated that inhibition of CCT3 could suppress malignant proliferation of human PTC, making CCT3 a promising molecular marker of PTC [25]. Since we observed the significant inhibition effect of AuNPs on the metastasis of PTC cells, we examined the molecular mechanisms with respect to CCT3. Stimulated by AuNPs, the mRNA level of CCT3 in BCPAP and TPC-1 cells reduced (Figure 5(a)), and the protein level of CCT3 was also decreased (Figure 5(b)) which was further confirmed by immunofluorescence (Figure 5(c)). These results demonstrated that CCT3 may have a major role in the mechanism of inhibition effects of AuNPs in PTC cells.

3.6. AuNPs Inhibited Proliferation, Migration, and Invasion, and Induced Apoptosis via Downregulating CCT3 in Papillary Thyroid Carcinoma Cells

To deeply investigate the mechanism of inhibition effects of AuNPs on PTC cells, we knocked down CCT3 by shRNA in BCPAP and TPC-1 cells which have the highest expression of CCT3 among PTC cell lines. Hence, we detected the mRNA and protein levels of CCT3 in BCPAP and TPC-1 cells after transfection by qRT-PCR and western blot. As shown in Figures 6(a) and 6(b), the mRNA and protein levels of CCT3 were decreased to a certain content which exhibited the successfully knocked down of CCT3. In addition, the mRNA and protein levels of CCT3 were much lower after treated with AuNPs as determined. Firstly, we found that both AuNPs and sh-CCT3 inhibited cell proliferation, and combined treatment of AuNPs and sh-CCT3 influenced the cell viability markedly than either one of AuNPs and sh-CCT3 did in both BCPAP and TPC-1 cells (Figure 6(c)). Subsequently, cotreatment of AuNPs and sh-CCT3 was more efficient on inhibiting cell apoptosis than treated individually (Figure 6(d)). Furthermore, we investigated whether CCT3 knockdown could inhibit the migratory abilities of BCPAP and TPC-1 cells by performing the wound healing, transwell migration, and invasion assays. The results depicted that sh-CCT3 suppressed the migration and invasion efficiently in the presence than the absence of AuNPs (Figures 7(a) and 7(b)). Altogether, these findings indicated that AuNP-mediated suppression of PTC was at least partially through downregulating the mRNA level of CCT3.

4. Discussion

AuNPs have been applied in the biomedical field as intrinsic anticancer agents [26]. Unmodified AuNPs have been shown to affect the growth and metastasis of cancer cells. For instance, AuNPs were able to inhibit the cell viability and induce apoptosis in various cancer cell lines including HepG2 hepatocellular cancer cells [27], MCF-7 breast cancer cells [28], and B16F10 melanoma cells [29]. Furthermore, previous studies have indicated that AuNPs inhibited cell proliferation by downregulating cell cycle genes [30, 31]. Our results showed that unmodified AuNPs of 8 nm could reduce the survival of papillary thyroid carcinoma cells (BCPAP and TPC-1) in a dose-dependent manner. The size of AuNPs is known to influence the effects on the proliferation of various types of cells [10]. AuNPs with sizes between 1 and 2 nm have been shown to be highly toxic for different cells, while those of 14-100 nm have been reported to be comparatively nontoxic [16]. The cytotoxicity of AuNPs to cells varies upon cell types except size and concentration. To ensure safety, AuNPs with medium size between 5 and 10 nm were selected for further evaluations.

In our study, AuNPs were synthesized using tannic acid and sodium citrate and characterized by UV-Vis spectra, TEM, and DLS; the results were agreed with previous reports [28]. To evaluate the biological effects of AuNPs in BCPAP and TPC-1 cells, we employed MTT and EdU assays. AuNPs were found to be capable of suppressing cell proliferation in a dose-dependent manner, which was in accordance with previous reports [17]. We also discovered the roles of AuNPs in cell apoptosis by a flow cytometer and found that AuNPs could enhance apoptosis in BCPAP and TPC-1 cells. Existing reports have shown that AuNPs could induce apoptosis in human leukemia cells [12]. In addition, AuNPs caused an increase in the level of proapoptosis proteins and decreased expression of antiapoptosis protein (Bcl-2), all of which also exhibited the induction of apoptosis in BCPAP and TPC-1 cells. Previous reports have shown that similar AuNPs of 5-6 nm could induce the expression of Bax, a proapoptotic protein in the intrinsic apoptotic pathway mediated by the process of mitochondrial outer membrane permeabilization [32].

Most researches on AuNPs emphasize on cytotoxicity. However, the effects of AuNPs on cellular behaviors are very important. Many malignant tumors exert capability of metastasis which is the main reason of cancer-related mortality [33]. The migration of tumor cell is well-known to be a key step in tumor progression and metastasis [34]. In our study, the strong inhibition efficacy of AuNPs on migration and invasion was observed in papillary thyroid carcinoma cells (Figure 4), which were in line with other groups [35, 36] indicating that AuNPs may have potential function in the metastasis of papillary thyroid carcinoma. Previous reports have depicted that AuNPs could inhibit the migration and invasion of ovarian cancer cells through increasing nuclear stiffness [37]. AuNPs have also been demonstrated to influence the bidirectional crosstalk between pancreatic stellate cells and pancreatic cancer cells to suppress the migration [38].

We also explored the molecular mechanism of inhibition effects of AuNPs on thyroid cancer cells. The chaperonin containing TCP-1 (CCT) is necessary for the production of actin, tubulin, and other proteins, some of which are involved in cell progression [39, 40]. As one of the chaperonin compounds, the CCT is undertaking the folding of about 10% of the proteome in cell. Consequently, CCT compound was demonstrated to affect cancer cell proliferation [41]. CCT3 was previously identified as highly expressed protein among CCT complex in some human cancers including PTC cells [25] and hepatoma carcinoma cells [42]. A pervious study also demonstrated that CCT3 depletion could cause cell apoptosis and decreased capability of migration [24]. In our study, we used qRT-PCR, western blot, and immunofluorescence assays to analyze the mRNA and protein levels of CCT3 in BCPAP and TPC-1 cells after incubated with AuNPs and found that both the mRNA and protein levels of CCT3 were reduced compared with the control group. To further investigate whether AuNPs exerted its antitumor effects by downregulating CCT3, we knocked down CCT3 in PTC cell lines and measured cell proliferation using EdU assay. qPCR and western blot confirmed that CCT3 mRNA and protein levels were reduced to a certain content, and the much lower level of CCT3 after treated with AuNPs. EdU assay showed that silencing CCT3 greatly suppressed the proliferation of BCPAP and TPC-1 cells combined with AuNPs. We further observed that cell apoptosis was increased in the presence than the absence of AuNPs in BCPAP and TPC-1 cells after transfection. Moreover, similar results were suggested by wound healing and transwell migration assays.

5. Conclusions

In summary, our study provided evidence for the first time that AuNPs inhibited the growth of papillary thyroid cancer cells (BCPAP and TPC-1) including cell proliferation, migration, and invasion. In addition, we demonstrated that AuNPs exerted the antitumor effects through downregulating the mRNA expression of CCT3 of papillary thyroid cancer cells. These findings may serve as a novel target for developing new strategy to treat papillary thyroid cancers.

Data Availability

The [figures] data used to support the findings of this study are included within the article.

Conflicts of Interest

The authors declare that there is no conflict of interest regarding the publication of this paper.

Authors’ Contributions

Fangzhou Liu and Dawei Ma contributed equally to this study.

Acknowledgments

This study was financially supported by the National Natural Science Foundation of China (no. 81571806), the Key Projects of Jiangsu Provincial Science and Technology Department (grant no. BE2016796), and Jiangsu Province Science Foundation of Six Highest Peak of Talent (2017 no. WSN-053). We would like to extend our sincere gratitude to Shanghai Yihe Biotech Inc. for their technical support.

References

  1. C. S. Grant, “Recurrence of papillary thyroid cancer after optimized surgery,” Gland Surgery, vol. 4, no. 1, pp. 52–62, 2015. View at: Publisher Site | Google Scholar
  2. L. Davies, L. G. T. Morris, M. Haymart et al., “American association of clinical endocrinologists and American college of endocrinology disease state clinical review: the increasing incidence of thyroid cancer,” Endocrine Practice, vol. 21, no. 6, pp. 686–696, 2015. View at: Publisher Site | Google Scholar
  3. S.-M. Chow, S. C. K. Law, J. K. C. Chan, S.-K. Au, S. Yau, and W.-H. Lau, “Papillary microcarcinoma of the thyroid-prognostic significance of lymph node metastasis and multifocality,” Cancer, vol. 98, no. 1, pp. 31–40, 2003. View at: Publisher Site | Google Scholar
  4. P. Siironen, J. Louhimo, S. Nordling et al., “Prognostic factors in papillary thyroid cancer: an evaluation of 601 consecutive patients,” Tumour Biology, vol. 26, no. 2, pp. 57–64, 2005. View at: Publisher Site | Google Scholar
  5. S. Bothra, A. Chekavar, and S. Mayilvaganan, “Prognostic significance of the proportion of tall cell components in papillary thyroid carcinoma,” World Journal of Surgery, vol. 41, no. 10, p. 2644, 2017. View at: Publisher Site | Google Scholar
  6. M. Z. Ahmad, S. Akhter, G. K. Jain et al., “Metallic nanoparticles: technology overview & drug delivery applications in oncology,” Expert Opinion on Drug Delivery, vol. 7, no. 8, pp. 927–942, 2010. View at: Publisher Site | Google Scholar
  7. A. Schroeder, D. A. Heller, M. M. Winslow et al., “Treating metastatic cancer with nanotechnology,” Nature Reviews Cancer, vol. 12, no. 1, pp. 39–50, 2011. View at: Publisher Site | Google Scholar
  8. L. H. Fu, J. Yang, J. F. Zhu, and M. G. Ma, “Synthesis of gold nanoparticles and their applications in drug delivery,” in Metal Nanoparticles in Pharma, pp. 155–191, Springer, 2017. View at: Publisher Site | Google Scholar
  9. E. Y. Lukianova-Hleb, D. S. Wagner, M. K. Brenner, and D. O. Lapotko, “Cell-specific transmembrane injection of molecular cargo with gold nanoparticle-generated transient plasmonic nanobubbles,” Biomaterials, vol. 33, no. 21, pp. 5441–5450, 2012. View at: Publisher Site | Google Scholar
  10. R. R. Arvizo, S. Rana, O. R. Miranda, R. Bhattacharya, V. M. Rotello, and P. Mukherjee, “Mechanism of anti-angiogenic property of gold nanoparticles: role of nanoparticle size and surface charge,” Nanomedicine: Nanotechnology, Biology and Medicine, vol. 7, no. 5, pp. 580–587, 2011. View at: Publisher Site | Google Scholar
  11. R. R. Arvizo, S. Saha, E. Wang, J. D. Robertson, R. Bhattacharya, and P. Mukherjee, “Inhibition of tumor growth and metastasis by a self-therapeutic nanoparticle,” Proceedings of the National Academy of Sciences of the United States of America, vol. 110, no. 17, pp. 6700–6705, 2013. View at: Publisher Site | Google Scholar
  12. Y. Y. Tsai, Y. H. Huang, Y. L. Chao et al., “Identification of the nanogold particle-induced endoplasmic reticulum stress by omic techniques and systems biology analysis,” ACS Nano, vol. 5, no. 12, pp. 9354–9369, 2011. View at: Publisher Site | Google Scholar
  13. C. Freese, C. Uboldi, M. I. Gibson et al., “Uptake and cytotoxicity of citrate-coated gold nanospheres: comparative studies on human endothelial and epithelial cells,” Particle and Fibre Toxicology, vol. 9, no. 1, p. 23, 2012. View at: Publisher Site | Google Scholar
  14. L. F. de Araújo Vieira, M. P. Lins, I. M. M. N. Viana, J. E. dos Santos, S. Smaniotto, and M. D. dos Santos Reis, “Metallic nanoparticles reduce the migration of human fibroblasts in vitro,” Nanoscale Research Letters, vol. 12, no. 1, p. 200, 2017. View at: Publisher Site | Google Scholar
  15. T. Shanmugasundaram, M. Radhakrishnan, V. Gopikrishnan, K. Kadirvelu, and R. Balagurunathan, “Biocompatible silver, gold and silver/gold alloy nanoparticles for enhanced cancer therapy: in vitro and in vivo perspectives,” Nanoscale, vol. 9, no. 43, pp. 16773–16790, 2017. View at: Publisher Site | Google Scholar
  16. Y. Pan, S. Neuss, A. Leifert et al., “Size-dependent cytotoxicity of gold nanoparticles,” Small, vol. 3, no. 11, pp. 1941–1949, 2007. View at: Publisher Site | Google Scholar
  17. P. Orlowski, E. Tomaszewska, K. Ranoszek-Soliwoda et al., “Tannic acid-modified silver and gold nanoparticles as novel stimulators of dendritic cells activation,” Frontiers in Immunology, vol. 9, p. 1115, 2018. View at: Publisher Site | Google Scholar
  18. E. A. Untener, K. K. Comfort, E. I. Maurer, C. M. Grabinski, D. A. Comfort, and S. M. Hussain, “Tannic acid coated gold nanorods demonstrate a distinctive form of endosomal uptake and unique distribution within cells,” ACS Applied Materials & Interfaces, vol. 5, no. 17, pp. 8366–8373, 2013. View at: Publisher Site | Google Scholar
  19. K. Ranoszek-Soliwoda, E. Tomaszewska, E. Socha et al., “The role of tannic acid and sodium citrate in the synthesis of silver nanoparticles,” Journal of Nanoparticle Research, vol. 19, no. 8, p. 273, 2017. View at: Publisher Site | Google Scholar
  20. Y. Xiong, J. Chen, B. Wiley, Y. Xia, Y. Yin, and Z. Y. Li, “Size-dependence of surface plasmon resonance and oxidation for Pd nanocubes synthesized via a seed etching process,” Nano Letters, vol. 5, no. 7, pp. 1237–1242, 2005. View at: Publisher Site | Google Scholar
  21. X. Li, H. Zhou, L. Yang et al., “Enhancement of cell recognition in vitro by dual-ligand cancer targeting gold nanoparticles,” Biomaterials, vol. 32, no. 10, pp. 2540–2545, 2011. View at: Publisher Site | Google Scholar
  22. S. Kuphal, R. Bauer, and A.-K. Bosserhoff, “Integrin signaling in malignant melanoma,” Cancer Metastasis Reviews, vol. 24, no. 2, pp. 195–222, 2005. View at: Publisher Site | Google Scholar
  23. C. Gialeli, A. D. Theocharis, and N. K. Karamanos, “Roles of matrix metalloproteinases in cancer progression and their pharmacological targeting,” FEBS Journal, vol. 278, no. 1, pp. 16–27, 2011. View at: Publisher Site | Google Scholar
  24. Y. Zhang, Y. Wang, Y. Wei et al., “Molecular chaperone CCT3 supports proper mitotic progression and cell proliferation in hepatocellular carcinoma cells,” Cancer Letters, vol. 372, no. 1, pp. 101–109, 2016. View at: Publisher Site | Google Scholar
  25. X. Shi, S. Cheng, and W. Wang, “Suppression of CCT3 inhibits malignant proliferation of human papillary thyroid carcinoma cell,” Oncology Letters, vol. 15, no. 6, pp. 9202–9208, 2018. View at: Publisher Site | Google Scholar
  26. E. C. Dreaden, M. A. Mackey, X. Huang, B. Kang, and M. A. el-Sayed, “Beating cancer in multiple ways using nanogold,” Chemical Society Reviews, vol. 40, no. 7, pp. 3391–3404, 2011. View at: Publisher Site | Google Scholar
  27. X. L. Wei, Z. H. Mo, B. Li, and J. M. Wei, “Disruption of HepG2 cell adhesion by gold nanoparticle and paclitaxel disclosed by in situ QCM measurement,” Colloids and Surfaces B: Biointerfaces, vol. 59, no. 1, pp. 100–104, 2007. View at: Publisher Site | Google Scholar
  28. A. C. Barai, K. Paul, A. Dey et al., “Green synthesis of Nerium oleander-conjugated gold nanoparticles and study of its in vitro anticancer activity on MCF-7 cell lines and catalytic activity,” Nano Convergence, vol. 5, no. 1, p. 10, 2018. View at: Publisher Site | Google Scholar
  29. P. H. Lu, H. J. Li, H. H. Chang, N. L. Wu, and C. F. Hung, “Gold nanoparticles induce cell death and suppress migration of melanoma cells,” Journal of Nanoparticle Research, vol. 19, no. 10, 2017. View at: Publisher Site | Google Scholar
  30. J. . J. Li, L. Zou, D. Hartono, C. N. Ong, B. H. Bay, and L. Y. Lanry Yung, “Gold nanoparticles induce oxidative damage in lung fibroblasts in vitro,” Advanced Materials, vol. 20, no. 1, pp. 138–142, 2008. View at: Publisher Site | Google Scholar
  31. C. Lopez-Chaves, J. Soto-Alvaredo, M. Montes-Bayon, J. Bettmer, J. Llopis, and C. Sanchez-Gonzalez, “Gold nanoparticles: distribution, bioaccumulation and toxicity. In vitro and in vivo studies,” Nanomedicine: Nanotechnology, Biology and Medicine, vol. 14, no. 1, pp. 1–12, 2018. View at: Publisher Site | Google Scholar
  32. M. P. A. Luna-Vargas and J. E. Chipuk, “Physiological and pharmacological control of BAK, BAX, and beyond,” Trends in Cell Biology, vol. 26, no. 12, pp. 906–917, 2016. View at: Publisher Site | Google Scholar
  33. P. S. Steeg, “Targeting metastasis,” Nature Reviews Cancer, vol. 16, no. 4, pp. 201–218, 2016. View at: Publisher Site | Google Scholar
  34. P. Pandya, J. L. Orgaz, and V. Sanz-Moreno, “Modes of invasion during tumour dissemination,” Molecular Oncology, vol. 11, no. 1, pp. 5–27, 2017. View at: Publisher Site | Google Scholar
  35. W. Li, X. Li, S. Liu et al., “Gold nanoparticles attenuate metastasis by tumor vasculature normalization and epithelial–mesenchymal transition inhibition,” International Journal of Nanomedicine, vol. 12, pp. 3509–3520, 2017. View at: Publisher Site | Google Scholar
  36. Y. Pan, Q. Wu, L. Qin, J. Cai, and B. du, “Gold nanoparticles inhibit VEGF165-induced migration and tube formation of endothelial cells via the Akt pathway,” BioMed Research International, vol. 2014, Article ID 418624, 11 pages, 2014. View at: Publisher Site | Google Scholar
  37. M. R. K. Ali, Y. Wu, D. Ghosh et al., “Nuclear membrane-targeted gold nanoparticles inhibit cancer cell migration and invasion,” ACS Nano, vol. 11, no. 4, pp. 3716–3726, 2017. View at: Publisher Site | Google Scholar
  38. S. Saha, X. Xiong, P. K. Chakraborty et al., “Gold nanoparticle reprograms pancreatic tumor microenvironment and inhibits tumor growth,” ACS Nano, vol. 10, no. 12, pp. 10636–10651, 2016. View at: Publisher Site | Google Scholar
  39. K. I. Brackley and J. Grantham, “Activities of the chaperonin containing TCP-1 (CCT): implications for cell cycle progression and cytoskeletal organisation,” Cell Stress and Chaperones, vol. 14, no. 1, pp. 23–31, 2009. View at: Publisher Site | Google Scholar
  40. M. W. Melville, A. J. McClellan, A. S. Meyer, A. Darveau, and J. Frydman, “The Hsp70 and TRiC/CCT chaperone systems cooperate in vivo to assemble the von Hippel-Lindau tumor suppressor complex,” Molecular and Cellular Biology, vol. 23, no. 9, pp. 3141–3151, 2003. View at: Publisher Site | Google Scholar
  41. C. Boudiaf-Benmammar, T. Cresteil, and R. Melki, “The cytosolic chaperonin CCT/TRiC and cancer cell proliferation,” PLoS One, vol. 8, no. 4, article e60895, 2013. View at: Publisher Site | Google Scholar
  42. E. N. Qian, S. Y. Han, S. Z. Ding, and X. Lv, “Expression and diagnostic value of CCT3 and IQGAP3 in hepatocellular carcinoma,” Cancer Cell International, vol. 16, no. 1, p. 55, 2016. View at: Publisher Site | Google Scholar

Copyright © 2019 Fangzhou Liu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

1203 Views | 439 Downloads | 1 Citation
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.