Journal of Nanomaterials / 2019 / Article / Tab 1

Research Article

Antimicrobial and Substantivity Properties of Silver Nanoparticles against Oral Microbiomes Clinically Isolated from Young and Young-Adult Patients

Table 1

Oligonucleotides used in this study.

PrimerSequenceAmplicon (bp)Reference

S. mutansF: GCACCACAACATTGGGAAGCTCAGTT
R: GGAATGGCCGCTAAGTCAACAGGAT
433Hoshino et al. [40]
S. sobrinusF: TTCAAAGCAAGACCAAGCTAGT
R: CCAGCCTGAGATTCAGCTTGT
328Yoshida et al. [41]
S. sanguinisF: GGATAGTGGCTCAGGGCAGCCAGTT
R: GAACAGTTGCTGGACTTGCTTGTC
313Hoshino et al. [40]
S. salivariusF: GTGTTGCCACATCTTCACTCGCTTCGG
R: CGTTGATGTGCTTGAAAGGGCACCATT
544Hoshino et al. [40]
S. gordoniiF: CTATGCGGATGATGCTAATCAAGTG
R: GGAGTCGCTATAATCTTGTCAGAAA
440Hoshino et al. [40]
S. oralisF: TCCCGGTCAGCAAACTCCAGCC
R: GCAACCTTTGGATTTGCAAC
374Hoshino et al. [40]
P. gingivalisF: TGTAGATGACTGATGGTGAAAACC
R: ACGTCATCCCCACCTTCCTC
197Amano et al. [42]
T. forsythiaF: GCG TATGTAACCTGCCCGCA
R: TGCTTCAGTGTCAGTTATACC T
641Ashimoto et al. [43]
T. denticolaF: TTATACCGAATGTGCTCATTTACAT
R: TCAAAGAAGCATTCCCTCTTC TTCTTA
316Watanabe and Frommel [44]
P. nigrescensF: ATGAAACAAAGGTTTTCCGGTAAG
R: CCCACGTCTCTGTGGGCTGCGA
804Ashimoto et al. [43]
P. intermediaF: CAAAGATTCATCGGTGGA
R: GCCGGTCCTTATTCGAAG
375Stubbs et al. [45]