Journal of Nanomaterials

Journal of Nanomaterials / 2021 / Article
Special Issue

Novel Micro- and Nanomaterials for Pharmaceutical Applications

View this Special Issue

Research Article | Open Access

Volume 2021 |Article ID 9999484 | https://doi.org/10.1155/2021/9999484

Yang Hu, Nian Fu, Li Xian Chen, Jian Hua Xiao, Xue Feng Yang, "COX-2 Regulates the Proliferation and Apoptosis of Activated Hepatic Stellate Cells through CDC27", Journal of Nanomaterials, vol. 2021, Article ID 9999484, 16 pages, 2021. https://doi.org/10.1155/2021/9999484

COX-2 Regulates the Proliferation and Apoptosis of Activated Hepatic Stellate Cells through CDC27

Academic Editor: Songwen Tan
Received15 Mar 2021
Revised20 Mar 2021
Accepted01 Apr 2021
Published28 Apr 2021

Abstract

Cyclooxygenase-2 (COX-2) is an important rate-limiting enzyme in the synthesis of prostaglandins (PGs), which can be upregulated by various stimuli. COX-2 has been shown to be involved in the occurrence and development of hepatic fibrosis by regulating the proliferation and apoptosis of hepatic stellate cells (HSCs) in previous studies. The aims of the study are to study the mechanism of how COX-2 regulates the proliferation and apoptosis of HSCs and to provide new targets for the prevention and treatment of hepatic fibrosis. A short hairpin RNA targeting COX-2 was constructed, and the changes in proliferation and apoptosis of liver tissue cells and HSCs were observed, respectively. COX-2-shRNA-1 significantly suppressed the proliferation of HSCs in vivo. Moreover, knockdown of COX-2 significantly suppressed cell proliferation and accelerated cell cycle arrest and apoptosis in vitro. Among those differential genes related to cell proliferation and apoptosis, CDC27 and Sh3kbp1 were upregulated, but Plcd4 was suppressed. Mechanistically, the influence of COX-2 on HSCs partly depends on upregulating CDC27. Our results demonstrated that COX-2 regulates the proliferation and apoptosis of activated hepatic stellate cells through the CDC27 pathway. This study contributes to our understanding of the effect of COX-2 for the treatment of hepatic fibrosis.

1. Introduction

Hepatic fibrosis, a common pathophysiological process in many chronic liver diseases, is manifested by the excessive and abnormal deposition of extracellular matrix components in the liver. It is the necessary stage for the development of chronic liver disease to cirrhosis. It is now believed that liver fibrosis may be reversed to normal, while cirrhosis is not. However, there is no effective method for the treatment of liver fibrosis.

Cyclooxygenase-2 (COX-2) is an important rate-limiting enzyme in the synthesis of prostaglandin (PGs). COX-2 is hardly expressed in normal tissues, but can be upregulated when stimulated by various factors. Extensive research has shown that COX-2 participates in some pathological processes, such as cell malignant transformation, inflammatory response, and catalyzing the biosynthesis of arachidonic acid (AA) to affect disease processes. Research in the area of hepatic fibrosis showed that COX-2 is an important molecule that affects the development of it. Celecoxib, a COX-2 inhibitor, suppresses the hepatic fibrosis induced by bile duct ligation (BDL) and thioacetamide (TAA) [1]. Other researchers used CCL4 to replicate the model of hepatic fibrosis and found that COX-2 knockout mice had less necrosis, degeneration, and connective tissue hyperplasia than the wild-type mice [2]. These mice also had lower expression of α-smooth muscle actin (α-SMA) in the liver tissue and less serum hyaluronic acid (HA), collagen IV (IV-C), and collagen III (PC III). Short hairpin RNA was used to silence COX-2 in nonalcoholic fatty liver disease (NAFLD) rats, and the liver tissue steatosis, inflammatory degree, and hepatic fibrosis were significantly reduced in COX-2 silencing rats [3].

CDC27 is a core subunit of anaphase-promoting complex/cyclosome (APC/C). APC/C is a type of E3 ligase complex that regulates chromosome segregation and mitotic exit [4]. APC/C reportedly participates in the TGF-β signaling pathway, and TGF-β activates CDC27, which promoted liver fibrosis via the TGF-β pathway in both HSC and hepatocyte [5]. Recent evidence suggests that COX-2 may be involved in the development of hepatic fibrosis by regulating the proliferation and apoptosis of hepatic stellate cells (HSCs). SC-236, a selective COX-2 inhibitor, had an antihepatic fibrosis effect and significantly promoted the apoptosis and growth inhibition of isolated cultured HSCs [6]. Celecoxib, another COX-2 inhibitor, has been reported to suppress the formation of hepatic fibrosis in rats by inhibiting the proliferation of platelet-derived growth factor- (PDGF-) induced HSCs and promoting the apoptosis of these HSCs [1].

However, the mechanism of how COX-2 regulates the proliferation and apoptosis of HSCs remains unclear. Therefore, this study silenced the expression of COX-2 in hepatocytes and hepatic stellate cells in liver fibrosis rats by using short hairpin RNA. Then the changes of proliferation and apoptosis of HSCs and related gene expression profiles after COX-2 silencing were observed. Based on our experimental results, we found that COX-2 regulated the proliferation and apoptosis of activated hepatic stellate cells through the CDC27 pathway.

2. Materials and Methods

2.1. Animal Model

48 male SD rats (Nanjing Junke Bioengineering Co., Ltd.) were randomly divided into four groups by body weight: control group (control), liver fibrosis model group (model), null plasmid control group (sh-NC), and COX-2-shRNA-1 group (COX-2-shRNA-1). Except for the control group, the other 3 groups were fed a high-fat diet for 12 weeks after a week of adaptive feeding. Rats in the COX-2-shRNA-1 group and the sh-NC groups were injected with adenovirus plasmids and adenovirus no-load physique grains (PBS dilution) through the caudal vein from the beginning of the high-fat diet, respectively. The dose and time of injection were pfu/each and once weekly. Rats in the control group and the model group were given an equal volume of PBS through the caudal vein. After 12 weeks of rearing, the rats were sacrificed by caesarean section to take 0.5~1.5 g of the left lateral lobe of the rat liver and immediately put it into ice-cold William E medium filled with a mixed gas of 95% oxygen and 5% CO for subsequent experiments. This experiment had been approved by the Animal Management Committee of our hospital.

2.2. Reverse Transcription-PCR

Reverse transcription-PCR (RT-PCR) was used to detect the mRNA expression of COX-2, α-SMA, CDC27, Sh3kbp1, Serpinb2, cxcl10, Dusp6, Dusp1, TP53, and Phlcd4. Total RNA from each liver sample and HSCs was extracted by Trizol reagent (Generay Biotech, China), and cDNA was synthesized by using Revert Aid First Strand cDNA synthesis Kit (Ferramentas, Germany), according to the manufacturer’s instructions. PCR was performed under the manufacturer’s manual. Band intensity was measured by a densitometer and was normalized for comparison. RT-PCR was performed on target gene using specific primers (Table 1). GAPDH was selected as the internal reference gene. The expression level of gene was analyzed using the equation 2ΔΔCT method, where ; ; ; and 2ΔΔCT represents the multiple expression of gene in the experimental group relative to the control group.


GenePrimerSequencesLength (bp)

COX-2Forward
Reverse
ATCTAGTCTGGAGTGGGAGG
AATGAGTACCGCAAACGCTT
420
α-SMAForward
Reverse
TGTGCTGGACTCTGGAGATG
GATCACCTGCCCATCAGG
292
Serpinb2Forward
Reverse
GTAGATGTGAACGAGGAGG
GTATGGTGCGGGTAATGT
142
Cdc27Forward
Reverse
ACTGGCGACCTGTTACTA
CTGGCTTCTCACCTATTT
359
Sh3kbp1Forward
Reverse
AGAAATGGACAGCAGGAC
TTGTTTGATGACAGGAGC
271
Dusp1Forward
Reverse
TTGTTTGATGACAGGAGC
TGGAGACAGGGAAGTTGAAGA
171
Dusp6Forward
Reverse
CACGGTGACAGTGGCTTAC
AGACATTCTGGTTGGAGG
215
TP53Forward
Reverse
GGAGTGCAAAGAGAGCACTG
CTCATTCAGCTCTCGGAACA
134
Cxcl10Forward
Reverse
TTCCTGCAAGTCTATCCTG
TGTTCTTCTTCATTGTGGC
170
Plcd4Forward
Reverse
TTTTGGCAACATTAGCAC
GACAACCAGGGCAGATAG
438
GAPDHForward
Reverse
TATCGGACGCCTGGTTAC
GCATCAAAGGTGGAAGAAT
852

2.3. Immunohistochemistry

Liver tissues were fixed in 4% formaldehyde solution for 3 to 5 days. Then, tissues were removed from the fixative solution and trimmed to an appropriate shape and thickness. Tissues were dehydrated, transparented, and embedded in wax, then dewaxed with xylene and rehydrated with gradient alcohol. Three of the most important steps were blocking and inactivating endogenous peroxidase and performing antigen retrieval. Primary antibodies anti COX-2 and α-SMA were used and incubated overnight in a refrigerator at 4°C (PBS buffer solution instead of primary antibody as a negative control). The samples were transferred to room temperature and equilibrated for 30 minutes and rinsed with PBS for minutes before adding a secondary antibody. The secondary antibody was incubated at 37°C for 15 minutes and rinsed with PBS for minutes. DAB staining was used.

2.4. Culture of HSC Cell Lines

HSC cell lines (HSC-T6) were obtained from the American Type Culture Collection (ATCC) and were cultured at 37°C with 5% CO2 in a cell incubator. Cells were cultured in DMEM medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) plus 1% 100 μg/ml penicillin/streptomycin. Cells were seeded in 6-well plates and grown to reach 70% confluence before transfection. For transfecting cells, cells were transfected with different plasmids using FuGENE HD Transfection reagent (Roche, Switzerland) following the manual instruction. Then, transfected cells were harvested for molecular assays.

2.5. Cell Transfection

shRNA targeting COX-2 (COX-2-shRNA) or CDC27 (sh-CDC27) were synthesized by Win Run Biotechnology Co, Ltd. (Changsha, China). The applied shRNA sequences for COX-2 were as follows: COX-shRNA-1, 5-CCTCGTCCAGATGCTATCTTT-3; COX-shRNA-2, 5-AGTTCCAGTATCAGAACCGCATTGCCTCT-3; and COX-shRNA-3, 5-GACACCTTCAACATTGAAGACCAGGAGTA-3. The applied shRNA sequences targeting CDC27 were 5-CCGGGCCTATAACAGTGACTTGATTCTCGAGAATCAAGTCACTGTTATAGGCTTTTTTG-3. According to the manufacturer’s protocol, HSC-T6 cells () were seeded in 6-well plates, incubated for 24 h, and then 200 ng/ml specific shRNA or negative control (NC) was transfected into the cells by using Lipofectamine®2000 (Invitrogen; USA). Effects of the shRNA were evaluated by western blotting and RT-PCR. A fluorescence microscope was used to observe the expression of green fluorescent protein in cells to evaluate the fluorescence density.

2.6. MTT Assay

Cells were treated for 24 h, 48 h, and 72 h. Then, 5 mg/ml MTT solution (in PBS) was added into the basal medium at 1 : 10 ratio. After 4-hour incubation, the remaining MTT solution was removed, and cells were solubilized with dimethyl sulfoxide. Optical density (OD) values were measured at the wavelength of 490 nm to reflect cell viability: .

2.7. Flow Cytometry Assay

HSC-T6 cells were harvested after 48 h posttransfection. The culture medium was then changed into serum-free Hank’s balanced salt solution. Then, cells were rinsed in pre-cold PBS. Fluorescein isothiocyanate- (FITC-) conjugated Annexin V and propidium iodine (PI) staining buffer were sequentially added. Cell apoptosis was then measured on a flow cytometry (BD, USA).

2.8. Cell Cycle Assay

Cell cycle of HSC-T6 cells was monitored by flow cytometry. After 48 h posttransfection, all groups of HSC-T6 cells were digested by trypsin and were washed in precold PBS. Cells were fixed by 70% cold ethanol overnight and were resuspended in 100 μg/ml RNase A in PBS for 30 min incubation at 37°C. Cell nuclei were stained by 50 μg/ml PI for 30 min. Cell cycle was then measured on flow cytometry using fluorescent-assisted cell sorting (FACS).

2.9. DNA Microarray Assay and Data Analysis

Microarray-based oligonucleotide hybridization approach was used to quantify expression levels of target gene [4]. In brief, total RNA was obtained as mentioned above. Then, the obtained sample RNA was labeled by fluorescence and turned into DNA. The labeled DNA was dissolved in 80 μl hybridization solution (, 0.2% SDS, , and 25% formamide) and hybridized at 42°C overnight. After the hybridization is completed, it was first washed in a liquid containing 0.2% SDS and at 42°C for 5 min and then washed in a medium for 5 minutes in room temperature. After the slide is dried, it can be used for scanning. LuxScan 3.0 software (CapitalBio Corp., China) was used firstly to transform images into digital signals. Linear correction across chips was performed based on global mean values of cy5 and cy3 signals for normalization of means. All data from this experiment can be divided into three groups: (1) all data include the whole signal data set containing those with or without differential expressions, and ratio values were defined after Lowess normalization. (2) Checked genes include those genes with effective signals after assay. (3) Differentially expressed genes were screened out and annotated by pathway and GO database for functional assay and statistical analysis using Capital Bio software.

2.10. Western Blotting

Western blotting was used to quantify the expression of COX-2 and CDC27. In brief, rat hepatic tissues or cultured HSCs were lysed in RIPA buffer and proteins were quantified by BCA kit. About 20~40ug protein samples were loaded onto SDS-PAGE gel for electrophoresis separation and were transferred to PVDF membrane. After blocking, the membrane was incubated with primary antibody including rabbit anti-COX-2 (#12282, CST, USA), rabbit anti-CDC27 (#9499, CST, USA), and rabbit anti-β-actin (#4970, CST, USA) overnight. On the next day, HRP-conjugated secondary antibody was added for room temperature incubation for 2 h. The membrane was then developed by ECL substrate, and images were captured by a computerized system.

2.11. Statistics

All data were presented as the (SD). The differences between two groups were analyzed using unpaired Student’s -test. One-way ANOVA was used for multiple groups. A statistical significance was defined when . All statistical analyses was performed using SPSS18.0 software.

3. Results

3.1. COX-2 Expression in Each Group after Knocking Down COX-2

To evaluate the transfection efficiency of COX-2-shRNA, the fluorescence density of cells exceeded 70-85%, as observed by the fluorescent microscope (Figure 1(a)). No fluorescent signal was observed in the control group, indicating a successful cell transfection. All the three-specific shRNA of COX-2 downregulate the COX-2 expression after transfection of 48 hours and 72 hours, and the most significant effect was caused by COX-2-shRNA-1 (, Figure 1(b)). After transfection of 24 hours, COX-2 mRNA decreased in the COX-2-shRNA-1-transfected group (). Further analysis of the results showed that a remarkably decreased COX-2 protein expression in the COX-2-shRNA-1-transfected group at 48 h () while the other two groups showed no major difference (Figure 1(c)). What emerges from the results reported here is that the construction of shRNA targeting COX-2 is successful and can be used for further experiments.

3.2. Knockdown of COX-2 Suppresses Proliferation of HSCs in Liver Tissue of Rats with Hepatic Fibrosis

To investigate the effect of COX-2 on proliferation and apoptosis of HSCs in the liver tissue of rats with hepatic fibrosis, we firstly generated a rat model in which COX-2 nanomedicine-shRNA-1 was injected. As the first evidence to support COX-2 nanomedicine for liver fibrosis, western blotting showed that the expression level of COX-2 nanomedicine in liver fibrosis model rats was significantly increased, and it can be effectively inhibited by transfection with COX-2 nanomedicine-shRNA-1 (, Figure 2(a)). As the indicator of HSC proliferation, the expression patterns of α-SMA showed similarity with COX-2 nanomedicine, as shown by the elevated expression in the model group and the downregulated expression in the COX-2 nanomedicine-shRNA-1 group (, Figure 2(b)). Detection of COX-2 nanomedicine and α-SMA in liver tissues by immunohistochemistry indicated that the expression trends of COX-2 nanomedicine and α-SMA were consistent with the results of western blotting (Figure 2(c)). Taken together, these results suggest that knockdown of COX-2 nanomedicine suppresses proliferation of HSCs in the liver tissue of rats with hepatic fibrosis.

3.3. Cox-2-shRNA-1 Suppressed Proliferation and Induced Apoptosis of HSCs In Vitro

Next, we investigated the effect of COX-2 knockdown on hepatic cell proliferation and apoptosis in vitro. Cell proliferation was remarkably inhibited after transfection at 72 h as demonstrated by the MTT assay (, Figure 3(a)). Further analysis of the cell cycle revealed that knockdown of COX-2 increased the percentage of cells arresting at G1 phase (Figure 3(b)). Moreover, cell apoptotic rate in the COX-2-shRNA-1 group was found significantly higher by FACS (, Figure 3(c)). Overall, these results suggest that knockdown of COX-2 effectively suppressed hepatic stellate cell proliferation and accelerating their apoptosis.

3.4. Changes in Expression of Dynamic Genes of Hepatic Stellate Cells after Knockdown of COX-2

To further investigate the mechanism of COX-2 in regulating proliferation and apoptosis of hepatic stellate cells, gene chip assay was used to compare differential between the untreated and treated cells. Gene chip results showed that 37 genes were upregulated and 8 genes were downregulated after shRNA transfection with 48 hours (Table 2). Analysis of cells after 72 hours transfection showed that 50 genes in HSCs showed increased, while 46 genes showed decreased (Table 3). We also performed GO annotation on those differentially expressed genes, among which three proliferation-associated genes were upregulated (Il6, Csf2, and Atf3) at 48 h, but without any downregulated gene. At 72 h, three proliferation genes (CDC27, TP53, and Cxcl10) were unregulated and three genes (DUsp1, Serpinb2, and Plcd4) were downregulated. For all 8 genes associated with cell apoptosis, we found four of them (Il1b, Il6, Ccl2, and Phlda3) were upregulated at 48 h and without any gene down-regulated. At 72 h, Tp53 was upregulated while Sh3kbp1, Pea15, and Plcd4 were suppressed (Tables 13). Those genes with significant changes were further validated by RT-PCR. As the results demonstrated that COX-2-shRNA-1 elevated CDC27, but decreased the Plcd4 gene transcripts. However, opposite trends were observed as Sh3kbp1 was upregulated, plus DUsp1 upregulated, in sharp contrast with DNA chip assay (Figures 4(a) and 4(b)). No significant change was found in other candidate genes (Figure 4(c)). In summary, COX-2-shRNA-1 modulated the cell proliferation and apoptosis related to the change in the expression of CDC27 and Plcd4.


Oligo_idNameRatioDescription

1Rn30002068Ppef27.8223Protein phosphatase
2Rn300090923.1274Immunoresponsive gene 1
3R001746_01Cxcl102.4468Small inducible cytokine B10 precursor
4Rn30015483Gbp42.4271Similar to guanylate nucleotide-binding protein 4
5Rn30001057Oasl12.41642-5-Oligoadenylate synthetase-like 1
6Rn300041852.3045Antisense RNA overlapping MCH protein.
7Rn30021148Ifit32.2743Tetratricopeptide repeat 3
8Rn30015485Gbp42.2279Similar to guanylate nucleotide-binding protein 4
9Rn30001055Oasl12.20372-5-Oligoadenylate synthetase-like 1
10Rn300201452.1558
11R000595_01Cx3cl12.0349Chemokine (C-X3-C motif) ligand 1
12Rn30020616Cxcl111.9534Chemokine (C-X-C motif) ligand 11
13R001188_01Il1b1.9086Interleukin-1 beta precursor (IL-1 beta).
14Rn30005625Mdm21.8729Similar to mdm2 gene product
15Rn30024865isg12(b)1.8722Putative ISG12(B) protein.
16Rn30016690Isg201.8707Interferon-stimulated protein (predicted)
17Rn30021722Apol9a1.8058
18Rn30005624Mdm21.767Similar to mdm2 gene product
19R003548_01Kcnt11.7082Potassium channel subfamily T member 1
20Rn30015487Gbp51.6855Similar to guanylate-binding protein 5
21R003549_01Csf21.6817Colony-stimulating factor
22R001026_01Atf31.665Cyclic AMP-dependent transcription factor ATF-3
23Rn30004011Scin1.6441Scinderin
24R001191_01Il61.6382Interleukin-6
25Rn30015486Gbp51.6332Similar to guanylate-binding protein 5
26Rn30008444Ifi27l1.6328Putative ISG12(a) protein
27Rn30008951Elovl41.6118Similar to Elovl4
28Rn30016019Irf71.5875Interferon regulatory factor 7
29R002891_01Cyp2d4v11.573Cytochrome P450 2D18
30Rn30001796Mx21.5626Interferon-induced GTP-binding protein Mx3.
31R000644_01Ccl21.5596Chemokine (C-C motif) ligand 2
32Rn300236931.5285
33Rn300262481.528Macrophage inflammatory protein 2-beta precursor
34Rn30016526Ccdc371.5222Similar to C230069K22Rik protein
35Rn30012826Aadac1.5185Arylacetamide deacetylase
36Rn30001056Oasl21.51412-5-Oligoadenylate synthetase-like 2
37Rn30008269Phlda31.502Pleckstrin homology-like domain family A member 3
38R003539_01Mapk8ip10.6656C-Jun-amino-terminal kinase-interacting protein 1
39Rn300260860.6545Ankyrin repeat domain 11
40Rn30018744Ptov10.6483Prostate tumor overexpressed gene 1
41Rn30003851Sh3kbp10.6376SH3-domain kinase binding protein 1
42Rn300018710.6282Steroid-sensitive protein 1
43R002280_01Thra_v20.6144Thyroid hormone receptor alpha
44R002312_01Pla2g2a0.512Phospholipase A2, membrane-associated precursor
45Rn300016100.4945Leucine-rich repeats and calponin homology (CH) domain containing 3


Oligo_idNameRatioDescription

1Rn300224546.1452Tripartite motif-containing 65
2Rn30006362Purb3.4474
3R001746_01Cxcl102.8634Small inducible cytokine B10 precursor
4Rn300201452.652
5Rn30001057Oasl12.60282-5-Oligoadenylate synthetase-like 1
6Rn30005291Cdc272.4796Cell division cycle 27 homolog
7Rn300064712.3552PFTAIRE protein kinase 1
8Rn30015483Gbp42.3519Similar to guanylate nucleotide-binding protein 4
9Rn300216732.3392¨C
10R000595_01Cx3cl12.3344Fractalkine precursor
11Rn30001055Oasl12.30482-5-Oligoadenylate synthetase-like 1
12Rn30002812Enah2.2328Enabled homolog
13Rn300181272.2025Diaphanous homolog 1
14Rn30024865isg12(b)2.2007Putative ISG12(B) protein
15Rn300254702.1365RNA-binding motif protein 27
16Rn300258802.0773Topoisomerase (DNA) II beta-binding protein
17Rn30021148Ifit32.0594Human interferon-inducible proteins
18Rn30002530Rfc12.035VIP-receptor-gene repressor protein
19Rn300069551.9683Peptidyl-prolyl cis-trans isomerase G
20Rn30024339Gbf11.9515Golgi-specific brefeldin A-resistance factor 1
21Rn30015485Gbp41.9459Similar to guanylate nucleotide-binding protein 4
22Rn30009903Trp531.8363Cellular tumor antigen p53
23Rn30010375
24Rn30006914Loxl31.7087Similar to lysyl oxidase-like 3
25Rn30018257Hsp90ab11.7047Heat shock protein HSP 90-beta (HSP 84).
26Rn30016830Chd41.6964Mi-2 autoantigen
27Rn30021722Apol9a1.6932¨C
28Rn30015487Gbp51.6803Similar to guanylate-binding protein 5
29Rn300090731.6721¨C
30Rn300089921.6509WAS protein family, member 2
31Rn30017948Psmb101.6478Proteasome subunit, beta type 10
32Rn300052831.644Rap1 interacting factor 1 homolog (yeast)
33Rn30019336Pogz1.6139Pogo transposable element with ZNF domain
34Rn30023995NIPBL1.6115PREDICTED: similar to delangin
35Rn30021836Olr12141.5675Olfactory receptor Olr1214
36R003169_01Acsl61.5651Long-chain-fatty-acid–CoA ligase 6
37R004194_01Zfp7091.565Zinc finger protein 14
38Rn30004337RGD15655971.5561Similar to RIKEN cDNA 2210421G13
39Rn300074541.5487Complement receptor 2
40Rn300032201.54513-day embryo male testis cDNA
41Rn30015924Trub11.5415TruB pseudouridine (psi) synthase homolog 1
42Rn30019481Gabpb21.5354Transcription factor GABP beta 2-1 chain
43Rn30009011RGD13055001.5248DNA segment, Chr 19, ERATO Doi 737
44Rn30015486Gbp51.5204Guanylate-binding protein 5
45Rn300154881.5197Guanylate nucleotide-binding protein 2
46R002891_01Cyp2d4v11.5187Cytochrome P450 2D18
47Rn300164341.5155RGD1310888-predicted protein
48Rn300010021.5108
49R001164_011.5085Granzyme M precursor
50Rn300230111.5073
51Rn30000745Hspa1b0.6661Heat shock 70 kDa protein 1A/1B
52Rn300108440.6653
53R002646_010.665
54Rn30013433Med310.6623RNA polymerase II transcription subunit 31
55Rn30003203Dynlt30.6605T-complex-associated testis-expressed 1-like
56Rn300220440.6596
57Rn30003825Nt5c1b0.6581Retinol dehydrogenase 14
58Rn30025065P4ha20.6576Procollagen-proline, 2-oxoglutarate-4-dioxygenase, alpha II polypeptide
59Rn30000745Hspa1b0.6555Heat shock 70 kDa protein 1A/1B
60Rn300199630.6548
61Rn30005770Ero1l0.6482ERO1-like protein alpha precursor
62Rn300241410.6465¨C
63Rn30019903Rassf10.6464Ras association domain family 1 isoform 2
64Rn30003533Dusp10.6461Dual specificity protein phosphatase 1
65Rn30020658RGD15636490.6446Similar to ORF4
66Rn30006166Pea15a0.6435Phosphoprotein enriched in astrocytes 15
67Rn30012217Arg10.6427Arginase-1 (EC 3.5.3.1)
68Rn300233340.6392
69Rn30023867Rnase1l20.6379
70Rn30002222Pgk10.6341Phosphoglycerate kinase 1
71R002211_01Aldoc0.6301Fructose-bisphosphate aldolase C
72Rn30002683RGD15605530.6288PREDICTED: similar to hypoxia-induced gene 1
73Rn300189430.6233DNA-3-methyladenine glycosylase
74Rn300062430.619
75Rn300253570.6154
76Rn30000745Hspa1b0.6086Heat shock 70 kDa protein 1A/1B
77Rn30003851Sh3kbp10.6013SH3-domain kinase binding protein 1
78Rn30000745Hspa1b0.5944Heat shock 70 kDa protein 1A/1B
79Rn30005084LOC4997420.5851LRRGT00150.
80Rn30000745Hspa1b0.5848Heat shock 70 kDa protein 1A/1B
81Rn30015841Bnip30.581BCL2/adenovirus E1B-interacting protein 3
82Rn30014271RGD15598150.5793Da1-12
83Rn30000745Hspa1b0.5732Heat shock 70 kDa protein 1A/1B
84Rn30000745Hspa1b0.5731Heat shock 70 kDa protein 1A/1B
85Rn30000745Hspa1b0.5706Heat shock 70 kDa protein 1A/1B
86Rn30000745Hspa1b0.5699Heat shock 70 kDa protein 1A/1B
87Rn30026196Hist1h4m0.5511Histone H4.
89Rn30000745Hspa1b0.545Heat shock 70 kDa protein 1A/1B
90Rn30024135LOC4996980.5425C-reactive protein precursor.
91Rn30000745Hspa1b0.5364Heat shock 70 kDa protein 1A/1B
92Rn30015672Car90.51Similar to carbonic anhydrase 9
93Rn30004468Upp10.4769Uridine phosphorylase 1
94Rn30014956Plcd40.4744Phospholipase C, delta 4
95R001854_01Ccl200.4709Small inducible cytokine A20 precursor
96Rn30022206Dusp60.4411Dual specificity protein phosphatase 6

3.5. COX-2-shRNA-1 Regulated the Proliferation and Apoptosis of HSCs through Regulating CDC27

CDC27 has been demonstrated in modulating cell proliferation [7] and apoptosis of tumor cells [8]. Therefore, we speculate that COX-2 may affect cell proliferation and apoptosis by affecting CDC27. Our conjecture was confirmed by the results that knockdown of COX-2 significantly elevated the protein level of CDC27, and this can be attenuated by knockdown of CDC27 (Figure 5(a)). The role of CDC27 on hepatic stellate cell proliferation was further investigated. Compared with the COX-2-shRNA-1 group, increased cell proliferation in the COX-2-shRNA-1+ sh-CDC27 group indicated the proproliferation effect of CDC27 (Figure 5(b)). In the previous results, knockdown of COX-2 induced more cells to arrest in G0/G1 phase, but on this basis, knockdown of CDC27 showed a weakened effect (Figure 5(c)). Cotransfection of CDC27-shRNA and COX-2-shRNA-1 decreased the cell apoptotic rate when compared with the COX-2-shRNA-1 group, suggesting that knockdown of CDC27 attenuated the proapoptotic effect of COX-2-shRNA-1 in HSCs (Figure 5(d)). What emerges from the results reported in the above is that COX-2 knockdown suppressed proliferation and accelerated apoptosis via activating CDC27 expression in HSCs.

4. Discussion

The primary effector cell in hepatic fibrosis is the HSCs [9]. HSCs are activated and transformed from quiescent to activated when the liver is damaged by mechanical stimulation or the inflammation. Activated HSCs have a strong ability to synthesize extracellular matrix, then leading to the formation of liver fibrosis or cirrhosis. Therefore, inhibiting the proliferation of HSCs and promoting its apoptosis have become the main strategy to treat liver fibrosis [10].

Previous studies have shown that COX-2 may be involved in the development of hepatic fibrosis by regulating the proliferation and apoptosis of HSCs [4]. SC-236 was used to prevent the occurrence of carbon tetrachloride-induced hepatic fibrosis in rats, which is mainly related to its regulation on the apoptosis and proliferation of HSCs [4]. However, the side effect of COX-2 inhibitors such as cardiovascular events or gastrointestinal bleeding limits its wide application [11]. Therefore, the nucleotide-based inhibitor for gene expression has been raised as a novel treatment approach. RNA interference (RNAi), a phenomenon of posttranscriptional gene silencing (PTGS), provides new insights for treating liver fibrosis [12]. Previous experiments showed that COX-2-shRNA-1 can effectively treat experimental liver fibrosis [3].

In this study, we found that knockdown of COX-2 effectively suppressed the proliferation of HSCs in the liver of rats with hepatic fibrosis, which has been proved by the decrease in α-SMA and the number of α-SMA immune-positive cells. More clearly, knockdown of COX-2 suppressed proliferation and facilitated apoptosis of HSCs. Our results were consistent with most literature reports [1, 6]. We argue that the regulation of COX-2 on HSC cell behavior might be the primary mechanism of it in hepatic fibrosis pathogenesis.

For the further evidences of COX-2 in regulating hepatic fibrosis, we employed mRNA microarray assay to examine the expression of a series of proliferative and apoptotic relative genes. Knockdown of COX-2 in HSCs leads to some cell proliferation genes to change; some of them upregulated, such as Il6, Csf2, Atf3, Cdc27, Tp53, and Cxcl10; and some of them downregulated including Dusp1, Serpinb2, and Plcd4. As for the apoptotic related genes, upregulation of Il1b, Il6, Ccl2, Phlda3, and Tp53 and downregulation of Sh3kbp1, Peal5, and Plcd4 genes were demonstrated. Sh3kbp1 gene may regulate various cell behaviors [13], and Plcd4 gene expression was associated with breast cancer cell proliferation [14]; CXCL10 induced cell proliferation and apoptosis [15, 16]. After silencing the COX-2 gene in HSCs, the expression of CDC27 is enhanced, which is the only gene with consistent results in DNA chips and RT-PCR. CDC27 was previously reported to facilitate proliferation [7]. It has potent protein binding affinity [8, 17] and participates in various biological processes including ubiquitination mediated proteolysis [18], cell cycle regulation [19], cell division [20], and transformation at metaphase of mitosis [21, 22]. In this study, we found that CDC27 knockdown could accelerate HSC proliferation and inhibit cell apoptosis, indicating that RNAi silencing of COX-2 could modulate HSCs growth, inhibit cell proliferation, and induce cell apoptosis via CDC27 upregulation. Moreover, CDC27 has been postulated to be one major target for induced cell apoptosis and cell cycle arrest in cancer cells [23]. The expression of COX-2 and CDC27 has been associated during immune response regarding macrophage proliferation [24]. This study, on the other hand, revealed the regulation of CDC27 gene expression by COX-2 knockdown, suggesting that CDC27 exerted its role at the downstream of COX-2. Our data thus provide the first-hand information on how COX-2 regulates HSC proliferation, cell cycle, and cell apoptosis by regulating CDC27 gene expression, revealing an unknown pathway of HSC behavior. However, the detailed molecular mechanism for COX-2 regulation on CDC27 gene expression is still unclear yet and thus requires further mechanistic studies to fulfill the weakness of the current study.

In summary, the current study described the regulation of HSC proliferation and apoptosis by COX-2/CDC27 axis and found that such regulatory pathway played important roles in mediating severity of hepatic fibrosis. Our overall findings provide a promising treatment target for early intervention of liver fibrosis.

Data Availability

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Ethical Approval

All animal procedures were approved by the Institutional Animal Care and Use Committee of University of South China (2011002A), Hengyang, China.

Conflicts of Interest

The authors declare no conflict of interest, financial, or otherwise.

Authors’ Contributions

Yang Hu designed the experiments. Yang Hu, Li Xian Chen, and Nian Fu performed the experiments and analyzed the date. Yang Hu wrote the manuscript. Jian Hua Xiao and Xue Feng Yang have modified the language expression of the article. All authors have read and approved the manuscript.

Acknowledgments

This study was funded by the Scientific Research Project of Hunan Provincial Health and Family Planning Commission (No. A2017015), the Hunan Provincial Union Fund for Natural Science and Cities (No. 2016JJ5010), the financial support from the Program for Hunan Provincial Science and Technology Department (No. 2018DK51707), and the National Natural Science Foundation of China (No. 81373465).

References

  1. Y. H. Paik, J. K. Kim, J. I. Lee et al., “Celecoxib induces hepatic stellate cell apoptosis through inhibition of Akt activation and suppresses hepatic fibrosis in rats,” Gut, vol. 58, no. 11, pp. 1517–1527, 2009. View at: Publisher Site | Google Scholar
  2. H. Hu, X. Jing, X. Zou, and J. Wu, “Role of cyclooxygenase 2 and its inhibitor valdecoxib in liver fibrosis,” Zhonghua Yi Xue Za Zhi, vol. 94, no. 10, pp. 784–787, 2014. View at: Google Scholar
  3. X. Ni, H. W. Liao, W. S. Ou et al., “Construction of COX-2 short hairpin RNA expression vector and its inhibitory effect on hepatic fibrosis,” Biotechnology & Biotechnological Equipment, vol. 32, no. 3, pp. 1–10, 2018. View at: Google Scholar
  4. L. Chang, Z. Zhang, J. Yang, S. H. McLaughlin, and D. Barford, “Atomic structure of the APC/C and its mechanism of protein ubiquitination,” Nature, vol. 522, no. 7557, pp. 450–454, 2015. View at: Publisher Site | Google Scholar
  5. J. Zhu, Z. Luo, Y. Pan et al., “H19/miR-148a/USP4 axis facilitates liver fibrosis by enhancing TGF-β signaling in both hepatic stellate cells and hepatocytes,” Journal of Cellular Physiology, vol. 234, no. 6, pp. 9698–9710, 2019. View at: Publisher Site | Google Scholar
  6. A. Planagumà, J. Clària, R. Miquel et al., “The selective cyclooxygenase-2 inhibitor SC-236 reduces liver fibrosis by mechanisms involving non-parenchymal cell apoptosis and PPARgamma activation,” The FASEB Journal, vol. 19, no. 9, pp. 1120–1122, 2008. View at: Google Scholar
  7. L. Qiu, J. Wu, C. Pan et al., “Downregulation of CDC27 inhibits the proliferation of colorectal cancer cells via the accumulation of p21Cip1/Waf1,” Cell death & disease, vol. 7, no. 1, p. e2074, 2016. View at: Publisher Site | Google Scholar
  8. V. P. Bermudez, S. A. MacNeill, I. Tappin, and J. Hurwitz, “The influence of the Cdc27 subunit on the properties of the Schizosaccharomyces pombe DNA polymerase delta,” Journal of Biological Chemistry, vol. 277, no. 39, pp. 36853–36862, 2002. View at: Google Scholar
  9. S. Karvar, E. A. Ansa-Addo, J. Suda et al., “Moesin, an ERM family member, regulates hepatic fibrosis,” Hepatology, vol. 72, no. 3, pp. 1073–1084, 2019. View at: Google Scholar
  10. S. Bi, F. Chu, M. Wang et al., “Ligustrazine-oleanolic acid glycine derivative, G-TOA, selectively inhibited the proliferation and induced apoptosis of activated HSC-T6 cells,” Molecules, vol. 21, no. 11, p. 1599, 2016. View at: Publisher Site | Google Scholar
  11. C. C. Szeto, K. Sugano, J. G. Wang et al., “Non-steroidal anti-inflammatory drug (NSAID) therapy in patients with hypertension, cardiovascular, renal or gastrointestinal comorbidities: joint APAGE/APLAR/APSDE/APSH/APSN/PoA recommendations,” Gut, vol. 69, no. 4, pp. 617–629, 2020. View at: Publisher Site | Google Scholar
  12. J. M. Bangen, L. Hammerich, R. Sonntag et al., “Targeting CCl4 -induced liver fibrosis by RNA interference-mediated inhibition of cyclin E1 in mice,” Hepatology, vol. 66, no. 4, pp. 1242–1257, 2017. View at: Publisher Site | Google Scholar
  13. R. Dejournett, R. Kobayashi, S. H. Pan et al., “Phosphorylation of the proline-rich domain of Xp95 modulates Xp95 interaction with partner proteins,” The Biochemical Journal, vol. 401, no. 2, pp. 521–531, 2007. View at: Publisher Site | Google Scholar
  14. D. W. Leung, C. Tompkins, J. Brewer et al., “Phospholipase C delta-4 overexpression upregulates ErbB1/2 expression, Erk signaling pathway, and proliferation in MCF-7 cells,” Molecular cancer, vol. 3, no. 1, p. 15, 2004. View at: Publisher Site | Google Scholar
  15. Q. Jiang, F. Wang, L. L. Shi et al., “C-X-C motif chemokine ligand 10 produced by mouse Sertoli cells in response to mumps virus infection induces male germ cell apoptosis,” Cell death & disease, vol. 8, no. 10, p. e3146, 2017. View at: Publisher Site | Google Scholar
  16. M. Wornle, H. Schmid, M. Merkle, and B. Banas, “Effects of chemokines on proliferation and apoptosis of human mesangial cells,” BMC Nephrology, vol. 5, no. 1, 2004. View at: Publisher Site | Google Scholar
  17. A. Schreiber, F. Stengel, Z. Zhang et al., “Structural basis for the subunit assembly of the anaphase-promoting complex,” Nature, vol. 470, no. 7333, pp. 227–232, 2011. View at: Publisher Site | Google Scholar
  18. L. A. MacFarlane and P. R. Murphy, “Regulation of FGF-2 by an endogenous antisense RNA: effects on cell adhesion and cell-cycle progression,” Molecular Carcinogenesis, vol. 49, no. 12, pp. 1031–1044, 2010. View at: Publisher Site | Google Scholar
  19. J. M. Pérez-Pérez, O. Serralbo, M. Vanstraelen et al., “Specialization of CDC27 function in theArabidopsis thalianaanaphase-promoting complex (APC/C),” The Plant Journal, vol. 53, no. 1, pp. 78–89, 2008. View at: Publisher Site | Google Scholar
  20. D. Li, G. Morley, M. Whitaker, and J. Y. Huang, “Recruitment of Cdc20 to the kinetochore requires BubR1 but not Mad2 in Drosophila melanogaster,” Molecular and Cellular Biology, vol. 30, no. 13, pp. 3384–3395, 2010. View at: Publisher Site | Google Scholar
  21. L. Zhang, T. Fujita, G. Wu, X. Xiao, and Y. Wan, “Phosphorylation of the anaphase-promoting complex/Cdc27 is involved in TGF-beta signaling,” The Journal of Biological Chemistry, vol. 286, no. 12, pp. 10041–10050, 2011. View at: Publisher Site | Google Scholar
  22. T. Fujita, M. W. Epperly, H. Zou, J. S. Greenberger, and Y. Wan, “Regulation of the anaphase-promoting complex-separase cascade by transforming growth factor-beta modulates mitotic progression in bone marrow stromal cells,” Molecular Biology of the Cell, vol. 19, no. 12, pp. 5446–5455, 2008. View at: Publisher Site | Google Scholar
  23. S. J. Lee and S. A. Langhans, “Anaphase-promoting complex/cyclosome protein Cdc27 is a target for curcumin-induced cell cycle arrest and apoptosis,” BMC Cancer, vol. 12, no. 1, 2012. View at: Publisher Site | Google Scholar
  24. W. C. Lim and V. T. Chow, “Gene expression profiles of U937 human macrophages exposed to Chlamydophila pneumoniae and/or low density lipoprotein in five study models using differential display and real-time RT-PCR,” Biochimie, vol. 88, no. 3-4, pp. 367–377, 2006. View at: Publisher Site | Google Scholar

Copyright © 2021 Yang Hu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Related articles

No related content is available yet for this article.
 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views179
Downloads355
Citations

Related articles

No related content is available yet for this article.

Article of the Year Award: Outstanding research contributions of 2021, as selected by our Chief Editors. Read the winning articles.