Journal of Nutrition and Metabolism / 2017 / Article / Tab 1

Research Article

Diet-Induced Obesity Is Associated with an Impaired NK Cell Function and an Increased Colon Cancer Incidence

Table 1

Characteristics of the specific primers used for real-time RT-PCR analysis.

GeneProteinSpeciesSequencebpNCBI reference

ActbBeta-actinHumanFw: GACGACATGGAGAAAATCTG131NM_001101
Rv: ATGATCTGGGTCATCTTCTC
PpiaCypARatFw: GTGTTCTTCGACATCACG92NM_017101
Rv: TGTCTGCAAACAGCTCGAAG
Klrk1NKG2DRatFw: TTAATGAGAACAAAGCCTGG199NM_133512
Rv: GTTAACTCGTTGGGTGATAG
Klrk1NKG2DHumanFw: AGGACAAAATGACCAAAGAC135NM_007360
Rv: CTTGGGGATATCTGAATTGC
Ncr1NKp46RatFw: AGACCCTGTTTCTTCTCTTG197NM_057199
Rv: TGAGCTTCTCATGATCCTTC
Ncr1NKp46HumanFv: CAGAAATGTATGACACACCC119NM_001145457
Rv: CTTGAGCAGTAAGAACATGC
Ncr3NKp30RatFw: AAGAGCCTCCTCAACAAG94NM_181822
Rv: AGAAAGCTGAGGGCATAG
Ncr3NKp30HumanFw: ATATGCCAAATCTACTCTCTCC200NM_001145466
Rv: TCTGATCCTTCCCATTTCTC

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.