Journal of Oncology / 2015 / Article / Tab 1

Research Article

Esculetin Downregulates the Expression of AML1-ETO and C-Kit in Kasumi-1 Cell Line by Decreasing Half-Life of mRNA

Table 1


Primer nameForward primersReverse primerProduct size (bp)

GUSB CTCATTTGGAATTTTGCCGATTCCGAGTGAAGATCCCCTTTTTA80
18S rRNAS GTGGTGTTGAGGAAAGCAGACATGATCACACGTTCCACCTCATC79
AML1-ETO CTACCGCAGCCATGAAGAACCAGAGGAAGGCCCATTGCTGAA395
C-Kit CACCGAAGGAGGCACTTACACGGAATCCTGCTGCCACACA148
LAT1 GAGCTACGAGAACGAGGGTGGCCTGGGTTGTGATAGTCGT157
RUNX3 GGATGGTACGGTGGTGACTGCTTGATGGCTCGGTGGTAGG208