Identification of Two DNMT3A Mutations Compromising Protein Stability and Methylation Capacity in Acute Myeloid Leukemia

Figure 2

Sanger sequencing of the insertion in the DNMT3A gene identified in AML#2 and analysis of clonal evolution based on NGS data. (a) AML#2 showed a novel insertion of 35 nucleotides in the exon 22 of the DNMT3A gene (c.2586_2587ins35: TCATGAATGAG AAAGAGGACATCTTATGGTGCAC; p Thr862_Glu863fsins). (b) Representation of clonal evolution of AML#2 from diagnosis to relapse (that occurred after 7 months of complete remission achieved with FLAI-5 chemotherapy regimen).

(a)

(b)