Journal of Ophthalmology / 2013 / Article / Tab 1

Research Article

RNA Interference Targeting Connective Tissue Growth Factor Inhibits the Transforming Growth Factor-β2 Induced Proliferation in Human Tenon Capsule Fibroblasts

Table 1

Targets and duplex sequences for human CTGF specific siRNAs and control siRNA.

siRNA duplexCTGF target sequence(5′-3′)siRNA duplex sequences

CTGF-siRNA1(1024)GCACCAGCATGAAGACATACC5′-GCACCAGCAUGAAGACAUACCdTdT-3′
5′-GGUAUGUCUUCAUGCUGGUGCdTdT-3′
CTGF-siRNA2(862)CCCGGGTTACCAATGACAACG5′-CCCGGGUUACCAAUGACAACGdTdT-3′
5′-CGUUGUCAUUGGUAACCCGGGdTdT-3′
CTGF-siRNA3(883)CCTCCTGCAGGCTAGAGAAGC5′-CCUCCUGCAGGCUAGAGAAGCdTdT-3′
5′-CCAAGCCUAUCAAGUUUGAGCdTdT-3′
CTGF-siRNA4(994)CCAAGCCTATCAAGTTTGAGC5′-CCAAGCCUAUCAAGUUUGAGCdTdT-3′
5′-GCUCAAACUUGAUAGGCUUGGdTdT-3′
control siRNA5′-UUCUCCGAACGUGUCACGUdTdT-3′
5′-ACUCCUCGCAGCAUUUCCCGGdTdT-3′

Four siRNAs were designed from the coding sequence of human CTGF gene. The target sequences (5′-3′) and the siRNA duplex sequences are listed, with the position of the first nucleotide in CTGF sequence shown in parentheses. A nonspecific, scrambled siRNA duplex as control siRNA was used as a control.

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.