Journal of Ophthalmology

Journal of Ophthalmology / 2016 / Article

Research Article | Open Access

Volume 2016 |Article ID 4353957 | 8 pages | https://doi.org/10.1155/2016/4353957

A Novel CRYBB2 Stopgain Mutation Causing Congenital Autosomal Dominant Cataract in a Chinese Family

Academic Editor: Patrik Schatz
Received28 May 2016
Revised08 Aug 2016
Accepted18 Aug 2016
Published29 Nov 2016

Abstract

Congenital cataract is the most common cause of the visual disability and blindness in childhood. This study aimed to identify gene mutations responsible for autosomal dominant congenital cataract (ADCC) in a Chinese family using next-generation sequencing technology. This family included eight unaffected and five affected individuals. After complete ophthalmic examinations, the blood samples of the proband and two available family members were collected. Then the whole exome sequencing was performed on the proband and Sanger sequencing was applied to validate the causal mutation in the two family members and control samples. After the whole exome sequencing data were filtered through a series of existing variation databases, a heterozygous mutation c.499T<G (p.E167X) in CRYBB2 gene was found. And the results showed that the mutation cosegregated with the disease phenotype in the family and was absolutely absent in 1000 ethnicity-matched control samples. Thus, the heterozygous mutation c.499T<G (p.E167X) in CRYBB2 was the causal mutation responsible for this ADCC family. In conclusion, our findings revealed a novel stopgain mutation c.499T<G (p.E167X) in the exon 6 of CRYBB2 which expanded the mutation spectrum of CRYBB2 in Chinese congenital cataract population and illustrated the important role of CRYBB2 in the genetics research of congenital cataract.

1. Introduction

Cataract, which often leads to visual impairment or blindness, can be unilateral or bilateral, congenital, or acquired [1]. Congenital cataract is one of the most common visual disorders during infancy or childhood and approximately affected 1–6 and 5–15 per 10,000 birth in industrialized and poor areas, respectively [25]. Any factors affecting the development of the fetalis lens might lead to occurrence of congenital cataract, such as heredity, the matrix virus infection in pregnancy, and pregnant women suffering from metabolic diseases. Congenital cataract is often characterized by clinical and genetic heterogeneity [5]. Different mutations can cause similar cataract phenotypes, such as the Coppock-like cataract mutations [6, 7], while the same variation may result in different cataract patterns such as the mutation p.Q155X in CRYBB2 gene [8, 9]. Multiple genetic studies revealed that about one-third of congenital cataract was associated with genetic factor [10]. Up to now, an increasing number of loci and genes (over 44 loci and 38 genes, resp.) were identified to be associated with congenital cataract [1114]. Among these mutations, about half are in crystalline genes, mainly including CRYAA, CRYAB, CRYBA4, CRYBB1, CRYBB2, and CRYGC [15]; one-quarter of mutations are in connexin genes, such as GJA3 and GJA [16, 17]; the remaining mutations are other genes which consist essentially of HSF4 [18], MIP [19], and EPHA2 [20]. Although autosomal dominant congenital cataract (ADCC) is the major inherited mode of congenital cataract, there were a few reports about autosomal recessive [2123] and X-linked inheritance mode [24, 25].

Our study is a genetic study in which we attempted to identify the disease gene in a four- generation Chinese family with autosomal dominant congenital cataract through the exome sequencing and direct sequencing. After analysis and validation, a novel mutation c.499T<G, in the exon 6 of CRYBB2, resulting in a truncation of 39 amino acids from the COOH-terminal end of B2-crystallin, was identified to be the disease causing mutation for the congenital cataract in this family. These findings provided evidence to expand the mutation spectrum of CRYBB2 in the Chinese congenital cataract population and we could further offer some clues to the molecular genetic mechanism of congenital cataract.

2. Materials and Methods

2.1. Subjects and Clinical Evaluation

This study was approved by the Institutional Review Board of the Hospital of University of Electronic Science and Technology of China and Sichuan Provincial People’s Hospital. All the participants were Han Chinese. Written informed consent was obtained in adherence to the Declaration of Helsinki for all the subjects or their guardians prior to the study. A four-generation Chinese family with congenital cataract from Sichuan Province of China consisting of thirteen members (eight unaffected and five affected individuals) and 1000 ethnicity-matched control subjects were recruited from the Hospital of University of Electronic Science and Technology of China and Sichuan Provincial People’s Hospital. Complete ophthalmic examinations were applied in the three members of the family (III:5, III:6, and IV:1) including visual acuity (by standard logarithmic visual acurity chart), intraocular pressure (by noncontact ophthalmotonometer), slit-lamp ophthalmoscopy, and indirect ophthalmoscopy under dilated pupils (by the supplementary lens). The ethnicity-matched control subjects were with no family history or eye diseases. This is a genetic study in which we used the genetic method to illustrate the cause of congenital cataract (the heritage disease). Clinical information about the three members in the family was listed in the Table 1.


IDAge/genderRelationshipType of cataractOnset age (months)Surgery age (year)Visual acuityMutationMutation type
ODOS

III:526/FProbandADCCSince birth9 (left eye)0.080.02c.499T<G p.E167XHet
III:644/MProband’ husbandNormalNormalNormal1.01.0
IV:18/MProband’ sonADCCSince birth2 (both eyes)0.10.01c.499T<G p.E167XHet

2.2. DNA Samples

Venous blood of each participant including III:5, III:6, and IV:1 was obtained from cubital vein and collected in an EDTA tube. The total genomic DNA was extracted by using a blood DNA extraction kit according to the protocol provided by the manufacturer (TianGen, Beijing, China). DNA integrity was evaluated by 1% agarose gel electrophoresis. Then all DNA samples were stored at −20°C until being used.

2.3. Exome Screening of the Proband

Whole exome sequencing technology is a useful tool for identifying disease causing mutations which could target the coding regions of the human DNA. In this study, the genomic DNA sample of the proband in this family was subjected to the exome sequencing by Axeq Technology Inc., Seoul, Korea. The sample was prepared strictly in accordance with the Illumina protocols of Sure Select Target Enrichment System Capture Process. Briefly, the genomic DNA sample was randomly fragmented according to the principle of nebulization. Then, the 250–300 bp fragments of DNA were subjected to three enzymatic steps: end repair, A-tailing, and adapter ligation. Afterwards, the specific product was amplified by ligation-mediated polymerase chain reaction (PCR) and validated using the Agilent Bioanalyzer. Each captured library was then loaded onto the Illumina HiSeq2000 sequencer. Then we use Illumina base calling software V1.7 to analyze the raw image files with default parameters.

2.4. Read Mapping and Variant Analysis

Briefly, the read was mapped against UCSC hg19 (http://genome.ucsc.edu/) by BWA (http://bio-bwa.sourceforge.net/). The SNPs and Indels are detected by SAMTOOLS (http://samtools.sourceforge.net/). Single-nucleotide polymorphism (SNP) analysis was performed as follows. (1) Reads was aligned to the NCBI human reference genome (gh19/NCBI 37.1) with SOAPaligner method V2.21. (2) For paired-end read with duplicated start and end sites, only one copy with the highest quality was retained and the read with adapters was removed. (3) SOAPsnp V1.05 was used to assemble the consensus sequence and call genotypes. (4) The read with alignment length less than 75 bp was removed. The Unified Genotyper tool from GATK V1.0.4705 was applied to detect the small insertions and deletions (Indels) SNP and Indel detection were performed only on the targeted exome regions and flanking regions within 200 bp.

2.5. Filtering and Annotation

Three major steps were taken to prioritize all the high-quality variants among cataract-related genes: (i) variants within intergenic, intronic, and UTR regions and synonymous mutations were excluded from later analysis; (ii) variants with high frequency in dbSNP137 (http://www.ncbi.nlm.nih.gov/projects/SNP/), 1000 Genome project (ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp), YH Database (http://yh.genomics.org.cn/), HapMap Project (ftp://ftp.ncbi.nlm.nih.gov/hapmap), and our in-house database, which was generated by our laboratory using 1800 whole exome sequencing data, were further excluded.

2.6. Mutation Validation with Sanger Sequencing

The whole exome sequencing and data analysis has revealed a heterozygous mutation in CRYBB2 gene. Then direct sequencing was utilized to identify the variation in the family members and the normal subjects. PCR primers aiming to amplify fragments flanking the candidate loci were synthesized by Invitrogen, Shanghai, China (CRYBB2-exon6-F: ctc gcctctctctctgtctg; CRYBB2-exon6-R: gacccacagcagacaagttg). The direct sequencing was conducted on the ABI 3730 Genetic Analyzer (Applied Biosystems) following the standard procedures and the data were analyzed via the Human Genomic Database.

3. Results

3.1. Clinical Date of the Family

A four-generation family with congenital cataract from Sichuan Province of China including eight unaffected and five affected individuals were enrolled in our study. As the pedigree chart shown (Figure 1), the cataract exhibited an autosomal dominant inheritance pattern in the family. The proband (III:5), a 26-year-old female, was diagnosed with bilateral cataract in early childhood. Among the family members, the clinical information and blood samples of III:5 (the proband), III:6 (the husband of the proband, unaffected), and IV:1 (the son of the proband, affected) were available. The two affected members (the mother and her son) shared similar clinical features: an early-onset and significant loss of vision acuity (OD: 0.08/0.1, OS: 0.02/0.01, resp.), nystagmus, and strabismus in both eyes. The slit-lamp photographs of the two affected members in this family indicated that the lens were completely absorbed (Figure 2).

3.2. Whole Exome Sequencing and Data Analysis

The whole exome sequencing was performed at Axeq Technology Inc., Seoul, Korea, using the DNA sample from the proband (III:5). And we identified a total of 20726 SNPs in coding regions (9475 nonsynonymous SNPs, 10852 synonymous SNPs, and 399 other types of SNPs) and 495 coding Indels that may affect amino acid sequence using the mean read depth of target regions (62.3x) (Table 2). It is well known that functional SNP/Indel, mainly including nonsynonymous variants (NS), splice acceptor and donor site mutations (SS), and frameshift coding-region insertions or deletions (Indels), are more likely to be the disease-causing mutations. In our study, we have successfully identified 6315 functional SNPs and 231 functional Indels. We compared these variants with the known cataract genes and 41 variants were found. We then subsequently compared these variants in the proband with the dbSNP137, 1000 Genomes Project, HapMap project, YH database, and our in-house generated database using 1800 whole exome sequencing pieces of data, of which, the in-house data was chiefly applied to exclude the variants with high frequency in normal controls. Based on the autosomal dominant mode of inheritance, we finally shirked down the filtered data to one heterozygous variant, the heterozygous mutation c.499T<G (p.E167X) in CRYBB2 gene.


Feature_SNPs and Indels in patient III:5 of family ADCC

Total_SNPs69447
Total Indels6873
Coding_SNP/Indels20726/495
Functional_SNP/Indels6315/231
Filtered_known gene41
Filtered_DBsnp137common/indel
Filtered_DBsnp/indel_1000gene(2011)38
Filtered_DBsnp_1000gene_Hapmap_YH
Filtered in House Data4
heterozygous1

Total_SNPs, Total Indels, Coding_SNP/Indels, and Functional_SNP/Indels: the date was provided by the “human exome capture sequencing date analysis report” and we made a statistical analysis about them.
Filtered_known gene: we filtered known gene mainly based on the related references.
Filtered_DBsnp137common/indel, Filtered_DBsnp/indel_1000gene(2011), and Filtered_DBsnp_1000gene_Hapmap_YH: they are some public databases and all the versions of databases used in our paper were the latest versions. The access date in which we accessed the public databases was about in April 2016.
Filtered in House Data: it is our lab’s database which was generated by our laboratory using 1800 whole exome sequencing data.
3.3. Mutation Detection and Analysis

Direct sequencing was used to further identify the variation of CRYBB2 in the family members including III:5 (the proband), III:6 (the husband of the proband, unaffected), and IV:1 (the son of the proband, affected). The heterozygous mutation c.499T<G (p.E167X) was carried by the mother III:5 and her son IV:1, while her husband III:6 did not carry this mutation (shown in Figure 3(a)). Sanger sequencing analysis showing the heterozygous variant c.499T<G (p.E167X) cosegregated with the phenotype. Meanwhile, the mutation was not identified in the 1000 normal controls by Sanger sequencing. We also checked the mutation in the newly available ExAC database of 63,000 control exomes (http://exac.broadinstitute.org/) and no variants were reported in this locus of CRYBB2 gene. Taken together, these results including the clinical information indicated that the heterozygous mutation c.499T<G (p.E167X) in the exon 6 of CRYBB2 gene is the causal mutation responsible for congenital cataract in this family.

According to GenBank accession number NM_000487.1, the novel stopgain mutation c.499T<G (p.E167X) in CRYBB2 gene found in our study eventually introduced a loss of 39 amino acids from βB2-crystallin (including 205 amino acids). As shown in Figure 3(b), the amino acid changes affected highly conserved residues in eight species which might influence the formation of the fourth Greek key in B2-crystallin. Therefore, the novel stopgain mutation was likely to affect the function of CRYBB2 protein.

4. Discussion

Congenital cataract, characterized by clinical and genetical heterogeneity, is mainly autosomal dominant inheritance [6]. The genetic factor can account for about one-third of congenital cataract cases [10]. With the development of molecular genetic techniques in recent decades, accumulating groups focus on the field of the genetic defects about congenital cataract. In this study, we have identified a novel mutation c.499T<G (p.E167X) in the exon 6 of CRYBB2 in a four-generation Chinese family affected with autosomal dominant congenital cataract by the whole exome sequencing and direct Sanger sequencing.

In the human lens, over 90% of lens soluble proteins are crystalline proteins including α-, -, and -crystallins with a proportion of 40%, 35%, and 25%, respectively. The early studies have revealed that the stability, ratio, and spatial sequence of crystallin proteins played a critical role in the lens transparency and light transmission [40, 4246]. Among them, B2-crystallin encoded by CRYBB2 gene is the most abundant and most soluble -crystallin in the lens [47]. As previously reported, scientists have already found that CRYBB2 gene, belonging to the crystallin genes, can account for approximately half cataract families with known mutations [48]. And in recent years, increasing mutations in the CRYBB2 gene, especially in the last two exons area, were found and reported to be associated with variable type of congenital cataract in different families and population.

The CRYBB2 gene (NM_000496) spanning 12.22 kb on chromosome 22q11.23 encodes βB2-crystallin protein containing 205 amino acids in human. It consists of six exons and is regarded as one of the most important genes for lens transparency. Among those exons, the first exon is not translated, the second encodes the NH2-terminal extension, and the remaining four exons contribute to one “Greek key” motif, respectively [49]. The B2-crystallin protein is a member of the -crystallin family and it is mainly expressed in human lens which can also be found in retina and brains [50]. The B2-crystallin protein has four “Greek key” motifs in which the first two (1 and 2) and the last two (3 and 4) are, respectively, in the NH2- and COOH-terminal domain [51]. Meanwhile B2-crystallin protein, as the major form of -crystallin, is not only the most soluble but also the least changed crystallin protein in a lifetime [47, 52]. Therefore, the solubility and arrangement of B2-crystallin play an important role in the development of human lens.

It is estimated that crystallin gene mutations can be responsible for approximately half of congenital cataract family [48]. And so far, at least fifteen mutations in the CRYBB2 gene which belongs to a member of crystallin genes have been uncovered with respect to several phenotypes of congenital cataract in different families and population, such as W59C, Q155X, and V187M (Table 3) [6, 8, 9, 2641]. And we can know that most of the mutations in the CRYBB2 gene centrally located in the last two exons (Figure 4). For example, p.Q155X mutation in the exon 6 resulted in a loss of 51 amino acids of βB2-crystallin which has been identified in different families and population. Yao et al. found that p.Q155X mutation can influence the formation of the fourth Greek key motif in the βB2-crystallin as well as probably changing the folding properties of βB2-crystallin [8]. Based on the mammalian two-hybrid system assay, spectroscopy (circular dichroism and fluorescence), and FPLC chromatography, scientists also discovered that p.Q155X mutation had an effect on the biophysical properties of βB2-crystallin (the decreased ordered structure and stability) which might be responsible for the cataract formation [53].


Bp exchangeAa exchangeBiologic consequenceOrigin of familyReference

c.C5Tp.A2VPosterior subcapsularChinese[26]
c.T62Ap.I21NADCCChinese[27]
c.C92Gp.S31WCoronary cataractChinese[28]
c.G54Ap.(=)ADCCIndian[29]
p.W59CADCCIndian[29]
c.A383Tp.D128VADCCGerman[30]
c.C428Tp.S143FADCCItalian[31]
c.C433Tp.E145WADCCDanish/German[32, 33]
c.G436Tp.V146MADCCChinese[27]
c.A440Gp.Q147RADCCDanish/German[32, 33]
c.C449Tp.T150MADCCDanish/German[32, 33]
c.G465Tp.W151CADCCChinese[34]
Central nuclearIndian[35]
c.C475Tp.Q155XSutural opacity and fish tail-like branchesAmerican[36]
CeruleanAmerican[37]
ADCCCanadian[6]
ADCCChilean[38]
Progressive polymorphic coronary ADCCIndian[9]
Cerulean ADCCChinese[39]
Progressive polymorphicChinese[8]
c.C477Ap.Y159XADCCDanish[32]
c.G607Ap.V187MNuclear cataractBasotho[40]
c.G563Ap.R188HADCCGerman[41]

In addition, some mutant lines in mice have been reported which could affect the βB2-crystallin such as Philly [54], Aey2 [55], and O377 [56] characterized by dominant, progressive cataracts. For example, O377 mutation (intron 5:_57 A->T) resulted in 19 additional amino acids in front of the fourth Greek key motif which might form an additional loop near the carboxyl terminus for βB2-crystallin [56]. Meanwhile, the Crybb2 knockout mice could develop cataracts 6–8 weeks after birth and cataract severity increased with age [57]. And we need further studies about Crybb2 animal models to elucidate the underlying molecular mechanism of which the CRYBB2 mutations contribute to the cataract. The CRYBB2 gene, in summary, plays a significant role both in the development of human and mice lens and it might be a critical region susceptible for mutations leading to lens opacity.

Likewise, the p.E167X mutation identified in our paper led to a truncation of 39 amino acids from the COOH-terminal end of B2-crystallin. This mutation occurred in a highly conserved region of the exon 6 which would influence the length of the COOH-terminal arm and the molecular weight of B2-crystallin protein. This alteration might affect the formation of the fourth Greek key in B2-crystallin. The early studies have provided some evidence that B2-crystallin played an important role in all three -crystallin aggregates, especially the C- and N-terminal extension [58]. Based on these studies, we could make such an assumption that the mutation p.E167X identified in this study would not be conducive to anchoring B2 subunit itself and the higher aggregation potentially resulting in a misfolded protein. In addition, some groups found that mutations may change the protein-protein interactions and further affect protein solubility and lens transparency [59]. All these studies provide us with new research directions. For the limitation of the animal model in the present study, the pathological mechanisms and functional study of CRYBB2 p.E167X causing congenital cataract would be further identified.

In conclusion, a novel stopgain mutation (p.E167X) in the exon 6 of CRYBB2 was identified in a four-generation Chinese family with ADCC and this mutation was likely to affect the formation of the fourth Greek key of B2-crystallin. Our findings could not only provide some evidence for the importance of B2-crystallin in the formation of cataract but also expand the mutation spectrum of CRYBB2 gene in Chinese congenital cataract population. In the future, function studies are needed to evaluate the definite molecular mechanism resulting from the p.E167X mutation.

Competing Interests

All the authors declare no competing interests.

Authors’ Contributions

Yu Zhou and Yaru Zhai contributed equally to this work.

Acknowledgments

This study was supported by grants from the Natural Science Foundation of China (81400437 to Yu Zhou and 81400401 to Yin Yang), Science and Technology Department of Sichuan Province (2016JZ0008 to Yu Zhou), and the Department of Sichuan Provincial Health (130176 to Yu Zhou). The authors alone are responsible for the content and the writing of the paper. They thank all subjects who participated in this study.

References

  1. M. Grałek, K. Kanigowska, and M. Seroczyńska, “Cataract in children—not only an ophthalmological problem,” Medycyna Wieku Rozwojowego, vol. 11, no. 2, pp. 227–230, 2007. View at: Google Scholar
  2. C. Gilbert and A. Foster, “Childhood blindness in the context of VISION 2020—the right to sight,” Bulletin of the World Health Organization, vol. 79, no. 3, pp. 227–232, 2001. View at: Google Scholar
  3. J. S. Rahi, S. Sripathi, C. E. Gilbert, and A. Foster, “Childhood blindness in India: causes in 1318 blind school students in nine states,” Eye, vol. 9, part 5, pp. 545–550, 1995. View at: Publisher Site | Google Scholar
  4. D. J. Apple, J. Ram, A. Foster, and Q. Peng, “Elimination of cataract blindness: a global perspective entering the new millenium,” Survey of Ophthalmology, vol. 45, pp. S1–S196, 2000. View at: Publisher Site | Google Scholar
  5. P. J. Francis, V. Berry, S. S. Bhattacharya, and A. T. Moore, “The genetics of childhood cataract,” Journal of Medical Genetics, vol. 37, no. 7, pp. 481–488, 2000. View at: Publisher Site | Google Scholar
  6. D. Gill, R. Klose, F. L. Munier et al., “Genetic heterogeneity of the Coppock-like cataract: a mutation in CRYBB2 on chromosome 22q11.2,” Investigative Ophthalmology & Visual Science, vol. 41, no. 1, pp. 159–165, 2000. View at: Google Scholar
  7. E. Héon, M. Priston, D. F. Schorderet et al., “The γ-crystallins and human cataracts: a puzzle made clearer,” The American Journal of Human Genetics, vol. 65, no. 5, pp. 1261–1267, 1999. View at: Publisher Site | Google Scholar
  8. K. Yao, X. Tang, X. Shentu, K. Wang, H. Rao, and K. Xia, “Progressive polymorphic congenital cataract caused by a CRYBB2 mutation in a Chinese family,” Molecular Vision, vol. 11, pp. 758–763, 2005. View at: Google Scholar
  9. F.-F. Li, S.-Q. Zhu, S.-Z. Wang et al., “Nonsense mutation in the CRYBB2 gene causing autosomal dominant progressive polymorphic congenital coronary cataracts,” Molecular Vision, vol. 14, pp. 750–755, 2008. View at: Google Scholar
  10. J. B. Bateman, M. A. Spence, M. L. Marazita, and R. S. Sparkes, “Genetic linkage analysis of autosomal dominant congenital cataracts,” American Journal of Ophthalmology, vol. 101, no. 2, pp. 218–225, 1986. View at: Publisher Site | Google Scholar
  11. A. Shiels and J. F. Hejtmancik, “Genetics of human cataract,” Clinical Genetics, vol. 84, no. 2, pp. 120–127, 2013. View at: Publisher Site | Google Scholar
  12. L. Yuan, Y. Guo, J. Yi et al., “Identification of a novel GJA3 mutation in congenital nuclear cataract,” Optometry and Vision Science, vol. 92, no. 3, pp. 337–342, 2015. View at: Publisher Site | Google Scholar
  13. H. Wang, T. Zhang, D. Wu, and J. Zhang, “A novel beaded filament structural protein 1 (BFSP1) gene mutation associated with autosomal dominant congenital cataract in a Chinese family,” Molecular Vision, vol. 19, pp. 2590–2595, 2013. View at: Google Scholar
  14. X.-Y. Xia, N. Li, X. Cao et al., “A novel COL4A1 gene mutation results in autosomal dominant non-syndromic congenital cataract in a Chinese family,” BMC Medical Genetics, vol. 15, article 97, 2014. View at: Publisher Site | Google Scholar
  15. A. C. Johnson, J. W. Lee, A. C. Harmon et al., “A mutation in the start codon of γ-crystallin D leads to nuclear cataracts in the Dahl SS/Jr-Ctr strain,” Mammalian Genome, vol. 24, no. 3-4, pp. 95–104, 2013. View at: Publisher Site | Google Scholar
  16. K. Guleria, K. Sperling, D. Singh, R. Varon, J. R. Singh, and V. Vanita, “A novel mutation in the connexin 46 (GJA3) gene associated with autosomal dominant congenital cataract in an Indian family,” Molecular Vision, vol. 13, pp. 1657–1665, 2007. View at: Google Scholar
  17. V. Vanita, J. R. Singh, D. Singh, R. Varon, and K. Sperling, “A mutation in GJA8 (p.P88Q) is associated with ‘balloon-like’ cataract with Y-sutural opacities in a family of Indian origin,” Molecular Vision, vol. 14, pp. 1171–1175, 2008. View at: Google Scholar
  18. L. Bu, Y. Jin, Y. Shi et al., “Mutant DNA-binding domain of HSF4 is associated with autosomal dominant lamellar and Marner cataract,” Nature Genetics, vol. 31, no. 3, pp. 276–278, 2002. View at: Publisher Site | Google Scholar
  19. X. Ding, N. Zhou, H. Lin et al., “A novel MIP gene mutation analysis in a Chinese family affected with congenital progressive punctate cataract,” PLoS ONE, vol. 9, no. 7, Article ID e102733, 2014. View at: Publisher Site | Google Scholar
  20. A. Shiels, T. M. Bennett, H. L. S. Knopf et al., “The EPHA2 gene is associated with cataracts linked to chromosome 1p,” Molecular Vision, vol. 14, pp. 2042–2055, 2008. View at: Google Scholar
  21. E. Heon, A. D. Paterson, M. Fraser et al., “A progressive autosomal recessive cataract locus maps to chromosome 9q13-q22,” The American Journal of Human Genetics, vol. 68, no. 3, pp. 772–777, 2001. View at: Publisher Site | Google Scholar
  22. P. L. Kramer, D. LaMorticella, K. Schilling, A. M. Billingslea, R. G. Weleber, and M. Litt, “A new locus for autosomal dominant congenital cataracts maps to chromosome 3,” Investigative Ophthalmology and Visual Science, vol. 41, no. 1, pp. 36–39, 2000. View at: Google Scholar
  23. H. Forsius, B. Arentz-Grastvedt, and A. W. Eriksson, “Juvenile cataract with autosomal recessive inheritance. A study from the Aland Islands, Finland,” Acta Ophthalmologica, vol. 70, no. 1, pp. 26–32, 1992. View at: Google Scholar
  24. P. J. Francis, V. Berry, A. J. Hardcastle, E. R. Maher, A. T. Moore, and S. S. Bhattacharya, “A locus for isolated cataract on human Xp,” Journal of Medical Genetics, vol. 39, no. 2, pp. 105–109, 2002. View at: Publisher Site | Google Scholar
  25. J. Francois, “Genetics of cataract,” Ophthalmologica, vol. 184, no. 2, pp. 61–71, 1982. View at: Publisher Site | Google Scholar
  26. K. Yao, J. Li, C. Jin et al., “Characterization of a novel mutation in the CRYBB2 gene associated with autosomal dominant congenital posterior subcapsular cataract in a Chinese family,” Molecular Vision, vol. 17, pp. 144–152, 2011. View at: Google Scholar
  27. K. J. Wang, B. B. Wang, F. Zhang, Y. Zhao, X. Ma, and S. Q. Zhu, “Novel β-crystallin gene mutations in chinese families with nuclear cataracts,” Archives of Ophthalmology, vol. 129, no. 3, pp. 337–343, 2011. View at: Publisher Site | Google Scholar
  28. D. Lou, J.-P. Tong, L.-Y. Zhang, S. W.-Y. Chiang, D. S.-C. Lam, and C. P. Pang, “A novel mutation in CRYBB2 responsible for inherited coronary cataract,” Eye, vol. 23, no. 5, pp. 1213–1220, 2009. View at: Publisher Site | Google Scholar
  29. S. T. Santhiya, G. S. Kumar, P. Sudhakar et al., “Molecular analysis of cataract families in India: new mutations in the CRYBB2 and GJA3 genes and rare polymorphisms,” Molecular Vision, vol. 16, pp. 1837–1847, 2010. View at: Google Scholar
  30. S. Pauli, T. Söker, N. Klopp, T. Illig, W. Engel, and J. Graw, “Mutation analysis in a German family identified a new cataract-causing allele in the CRYBB2 gene,” Molecular Vision, vol. 13, pp. 962–967, 2007. View at: Google Scholar
  31. F. Faletra, A. P. D'Adamo, S. Pensiero et al., “A novel CRYBB2 missense mutation causing congenital autosomal dominant cataract in an Italian family,” Ophthalmic Genetics, vol. 34, no. 1-2, pp. 115–117, 2013. View at: Publisher Site | Google Scholar
  32. L. Hansen, A. Mikkelsen, P. Nürnberg et al., “Comprehensive mutational screening in a cohort of Danish families with hereditary congenital cataract,” Investigative Opthalmology & Visual Science, vol. 50, no. 7, pp. 3291–3303, 2009. View at: Publisher Site | Google Scholar
  33. S. J. Garnai, J. R. Huyghe, D. M. Reed et al., “Congenital cataracts: de novo gene conversion event in CRYBB2,” Molecular Vision, vol. 20, pp. 1579–1593, 2014. View at: Google Scholar
  34. W. Chen, X. Chen, Z. Hu et al., “A missense mutation in CRYBB2 leads to progressive congenital membranous cataract by impacting the solubility and function of βB2-crystallin,” PLoS ONE, vol. 8, no. 11, Article ID e81290, 2013. View at: Publisher Site | Google Scholar
  35. S. T. Santhiya, S. M. Manisastry, D. Rawlley et al., “Mutation analysis of congenital cataracts in Indian families: identification of SNPs and a new causative allele in CRYBB2 gene,” Investigative Ophthalmology & Visual Science, vol. 45, no. 10, pp. 3599–3607, 2004. View at: Publisher Site | Google Scholar
  36. Vanita, V. Sarhadi, A. Reis et al., “A unique form of autosomal dominant cataract explained by gene conversion between β-crystallin B2 and its pseudogene,” Journal of Medical Genetics, vol. 38, no. 6, pp. 392–396, 2001. View at: Publisher Site | Google Scholar
  37. R. R. Devi, W. Yao, P. Vijayalakshmi, Y. V. Sergeev, P. Sundaresan, and J. F. Hejtmancik, “Crystallin gene mutations in Indian families with inherited pediatric cataract,” Molecular Vision, vol. 14, pp. 1157–1170, 2008. View at: Google Scholar
  38. J. B. Bateman, F. R. B. von-Bischhoffshaunsen, L. Richter, P. Flodman, D. Burch, and M. A. Spence, “Gene conversion mutation in crystallin, β-B2 (CRYBB2) in a chilean family with autosomal dominant Cataract,” Ophthalmology, vol. 114, no. 3, pp. 425–432, 2007. View at: Publisher Site | Google Scholar
  39. L. Wang, H. Lin, J. Gu, H. Su, S. Huang, and Y. Qi, “Autosomal-dominant cerulean cataract in a Chinese family associated with gene conversion mutation in beta-B2-crystallin,” Ophthalmic Research, vol. 41, no. 3, pp. 148–153, 2009. View at: Publisher Site | Google Scholar
  40. M. E. Mothobi, S. Guo, Y. Liu et al., “Mutation analysis of congenital cataract in a Basotho family identified a new missense allele in CRYBB2,” Molecular Vision, vol. 15, pp. 1470–1475, 2009. View at: Google Scholar
  41. N. Weisschuh, S. Aisenbrey, B. Wissinger, and A. Riess, “Identification of a novel CRYBB2 missense mutation causing congenital autosomal dominant cataract,” Molecular Vision, vol. 18, pp. 174–180, 2012. View at: Google Scholar
  42. J. R. Kuszak, R. K. Zoltoski, and C. Sivertson, “Fibre cell organization in crystalline lenses,” Experimental Eye Research, vol. 78, no. 3, pp. 673–687, 2004. View at: Publisher Site | Google Scholar
  43. G. Yang, C. Xiong, S. Li, Y. Wang, and J. Zhao, “A recurrent mutation in CRYGD is associated with autosomal dominant congenital coralliform cataract in two unrelated Chinese families,” Molecular Vision, vol. 17, pp. 1085–1089, 2011. View at: Google Scholar
  44. M. Kumar, T. Agarwal, S. Khokhar et al., “Mutation screening and genotype phenotype correlation of α-crystallin, γ-crystallin and GJA8 gene in congenital cataract,” Molecular Vision, vol. 17, pp. 693–707, 2011. View at: Google Scholar
  45. Q. Chen, J. Ma, M. Yan, M. E. Mothobi, Y. Liu, and F. Zheng, “A novel mutation in CRYAB associated with autosomal dominant congenital nuclear cataract in a Chinese family,” Molecular Vision, vol. 15, pp. 1359–1365, 2009. View at: Google Scholar
  46. L. Hansen, W. Yao, H. Eiberg et al., “Genetic heterogeneity in microcornea-cataract: five novel mutations in CRYAA, CRYGD, and GJA8,” Investigative Ophthalmology & Visual Science, vol. 48, no. 9, pp. 3937–3944, 2007. View at: Publisher Site | Google Scholar
  47. J. Feng, D. L. Smith, and J. B. Smith, “Human lens β-crystallin solubility,” Journal of Biological Chemistry, vol. 275, no. 16, pp. 11585–11590, 2000. View at: Publisher Site | Google Scholar
  48. A. Shiels and J. F. Hejtmancik, “Genetic origins of cataract,” Archives of Ophthalmology, vol. 125, no. 2, pp. 165–173, 2007. View at: Publisher Site | Google Scholar
  49. G. Inana, J. Piatigorsky, B. Norman, C. Slingsby, and T. Blundell, “Gene and protein structure of a β-crystallin polypeptide in murine lens: relationship of exons and structural motifs,” Nature, vol. 302, no. 5906, pp. 310–315, 1983. View at: Publisher Site | Google Scholar
  50. K. S. Magabo, J. Horwitz, J. Piatigorsky, and M. Kantorow, “Expression of βB2-crystallin mRNA and protein in retina, brain, and testis,” Investigative Ophthalmology and Visual Science, vol. 41, no. 10, pp. 3056–3060, 2000. View at: Google Scholar
  51. V. S. Kumaraswamy, P. F. Lindley, C. Slingsby, and I. D. Glover, “An eye lens protein-water structure: 1.2 Å resolution structure of γB-crystallin at 150 K,” Acta Crystallographica D: Biological Crystallography, vol. 52, part 4, pp. 611–622, 1996. View at: Publisher Site | Google Scholar
  52. Z. Zhang, L. L. David, D. L. Smith, and J. B. Smith, “Resistance of human βB2-crystallin to in vivo modification,” Experimental Eye Research, vol. 73, no. 2, pp. 203–211, 2001. View at: Publisher Site | Google Scholar
  53. B.-F. Liu and J. J.-N. Liang, “Interaction and biophysical properties of human lens Q155* βB2-crystallin mutant,” Molecular Vision, vol. 11, pp. 321–327, 2005. View at: Google Scholar
  54. C. Chambers and P. Russell, “Deletion mutation in an eye lens β-crystallin: an animal model for inherited cataracts,” Journal of Biological Chemistry, vol. 266, no. 11, pp. 6742–6746, 1991. View at: Google Scholar
  55. J. Graw, J. Löster, D. Soewarto et al., “Aey2, a new mutation in the βB2-crystallin-encoding gene of the mouse,” Investigative Ophthalmology and Visual Science, vol. 42, no. 7, pp. 1574–1580, 2001. View at: Google Scholar
  56. K. Ganguly, J. Favor, A. Neuhäuser-Klaus et al., “Novel allele of Crybb2 in the mouse and its expression in the brain,” Investigative Ophthalmology & Visual Science, vol. 49, no. 4, pp. 1533–1541, 2008. View at: Publisher Site | Google Scholar
  57. J. Zhang, J. Li, C. Huang et al., “Targeted knockout of the mouse βB2-crystallin gene (Crybb2) induces age-related cataract,” Investigative Ophthalmology and Visual Science, vol. 49, no. 12, pp. 5476–5483, 2008. View at: Publisher Site | Google Scholar
  58. P. G. Cooper, J. A. Carver, and R. J. W. Truscott, “1H-NMR spectroscopy of bovine lens β-crystallin. The role of the βB2-crystallin C-terminal extension in aggregation,” European Journal of Biochemistry, vol. 213, no. 1, pp. 321–328, 1993. View at: Publisher Site | Google Scholar
  59. L. Fu and J. J.-N. Liang, “Detection of protein-protein interactions among lens crystallins in a mammalian two-hybrid system assay,” The Journal of Biological Chemistry, vol. 277, no. 6, pp. 4255–4260, 2002. View at: Publisher Site | Google Scholar

Copyright © 2016 Yu Zhou et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

981 Views | 337 Downloads | 3 Citations
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.