Table 1: Primers for amplifying and sequencing PITX2 and FOXC1.

GeneExonForward primer (5′-3′)Reverse primer (5′-3′)Product size (bp)Annealing temperature (°C)

PITX22GGCCGCCGCTTCTTACACACTGGCGATTTGGTTCTGATTT25463
3CTGCCTCGCCCCTCCCCCTCCTCTTCAAGCAGCAGGCGCGTCAGGTC35064
4GGGGCAGTAGCCAAGGACTCAGCTAAGCGGGAATGTCTG28964
5GGCGCGGACACCCACACTTGGCGCTGCCTTCCACATTCTCT48765
6-AGCGCTGCCTTCCACATTCTCTGGTGGATAGGGAGGCGGATGTAAG34663
6-BGGTGGATAGGGAGGCGGATGTAAGCGACGGGCTACTCAGGTTGTTCA25664
6-CTCCCGGGCTCCAGTCTCAACAGTTTCTTTAGTGCCCACGACCTTCT35564
SSCP-1CGACGACATGTACCCAGGCTATTCGCGACGGGCTACTCAGGTTGTT25768
SSCP-2GGCGCGGACACCCACACTTGCTGCCGCCTTTGCCGCTTCTTCTT26968
SSCP-3CTGGCCCTGGTATCTTGGTGTGCGGTGGATAGGGAGGCGGATGTAAG34663

FOXC11-ACCCGGACTCGGACTCGGCAAGCGGTCCATGATGAACTGG42963
1-BGCGCACGCCGAGCAGTACACCGCGTCCTTCTTCTTGA39060
1-CCACCCTGAACGGCATCTACCAAGGCTGCTGCTGCTGCTGTCG50464
1-DGCCCGTGCGCATCCAGGACATCAAGCTGCCCGCGCTGGAGGTCTGG46364
1-EAGGGCTTCAGCGTGGACAACATCAGGTGGGCCGCAGGGTGGTG48265
1-FCAAGCCATGAGCCTGTACGGGGTTCGATTTAGTTCGGCT50260

Primer sequences, sizes of PCR products, and annealing temperatures used for the amplification are listed. Primers 2–6 were used to amplify and sequence the PITX2-coding segments. The sequencing of exon 6 of PITX2 was performed with three overlapping primers A–C. Primers SSCP-1 to SSCP-3 were used to amplify the novel variations detected in PITX2 for heteroduplex-SSCP analysis. The single FOXC1 exon was sequenced with six overlapping primers, A–F.