Journal of Pathogens / 2012 / Article / Tab 3

Research Article

Design and Construction of a Single-Tube, LATE-PCR, Multiplex Endpoint Assay with Lights-On/Lights-Off Probes for the Detection of Pathogens Associated with Sepsis

Table 3

LATE-PCR 16S sepsis multiplex primer and probe sequences.

PrimerSequence 5′ 3′Bases

16S limiting primerCCAGACTCCTACGGGAGGCAGCAGT25
16S excess primerGTATTACCGCGGCTGTGGCA20
Candida limiting Primer APTACCATTACCTCATTATTGGAGACGTGATGCTGC33
Candida excess Primer APTGCAATTTCTTGATCAGTCATTTTTACACCATCTT34
Candida limiting Primer GATGCCCAACAAGCTATCTCTGGTACTTACATGT33
Candida excess Primer GCGGATGTTGCAGGGGAAGTATGTTGACCACCCA33
L. lactis (control) Limiting PrimerCTAAAATCAGGAACTTCGTTATCTTTAGTAGTCACAACCA40
L. lactis (control) Excess PrimerTAATCATTATTCCTCAAGAAGAGATACAATCGGTCA36
Control probeCal Org 560-ATAAACCTTTCTTAAAAT-BHQ118
Candida APT probeCal Red 610-ATGTGATATTGATCCAAATCGTGATTTAATAT-BHQ232
Candida G probeQuasar 670-AAACAAGGATGGTACTAGGATGACCGTT-BHQ-228
16S Quasar 1 On Quasar 670-AAGCGAAAGCCTGATGCAGCCATT-BHQ224
16S Quasar 2 OnBHQ2-TAGCCGCGTGTGTGAAGAATA-Quasar 67021
16S Quasar 3 OnQuasar 670-TTATATGTGTAAGTAACTGTGCACATCAA-BHQ229
16S Quasar 4 OnQuasar 670-TTGAAGAAGCACCGGCTAACTCCGAA-BHQ227
16S Quasar 1 OffAAGGGGAATATTGCACAATGGTT-BHQ223
16S Quasar 2 OffBHQ2-TTGGCCTTCGGATTGTAAAGCACTTAA-C3 Carbon Linker27
16S Quasar 3 OffTATTAGTAGGGAGGAAGTA-BHQ219
16S Quasar 4 OffTTGACGTTACCCGCAA-BHQ216