Isolation of Environmental Bacteria from Surface and Drinking Water in Mafikeng, South Africa, and Characterization Using Their Antibiotic Resistance Profiles

Table 2

Oligonucleotide primers that were used to detect virulence genes in Aeromonas species.

Genes	Oligonucleotide sequence (5′-3′)	Target gene and size (bp)	PCR cycling conditions
aer A	Aer 2F: AGCGGCAGAGCCCGTCTATCCA; Aer 2R: AGTTGGTGGCGGTGTCGTAGCG	aerA (416)	30X 95°C for 2 m; 55°C for 1 m; 72°C for 1 m
hyl H	Hyl 2F: GGCCCGTGGCCCGAAGATGCAGG; Hyl 2R: CAGTCCCACCCACTTC	hylH (597)	30X 95°C for 2 m; 55°C for 1 m; 72°C for 1 m

Initial denaturing step of 95°C for 5 min and final strand extension of 72°C for 7 min.