Journal of Pathogens / 2014 / Article / Tab 2

Research Article

Isolation of Environmental Bacteria from Surface and Drinking Water in Mafikeng, South Africa, and Characterization Using Their Antibiotic Resistance Profiles

Table 2

Oligonucleotide primers that were used to detect virulence genes in Aeromonas species.

GenesOligonucleotide sequence (5′-3′)Target gene and size (bp)PCR cycling conditions

aer A Aer 2F: AGCGGCAGAGCCCGTCTATCCA 
Aer 2R: AGTTGGTGGCGGTGTCGTAGCG
aerA (416)30X 95°C for 2 m 
55°C for 1 m 
72°C for 1 m

hyl H Hyl 2F: GGCCCGTGGCCCGAAGATGCAGG 
Hyl 2R: CAGTCCCACCCACTTC
hylH (597)30X 95°C for 2 m 
55°C for 1 m 
72°C for 1 m

Initial denaturing step of 95°C for 5 min and final strand extension of 72°C for 7 min.

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.