Table 2: Oligonucleotide primers designed from the mRNA sequences retrieved from PlasmoDB.

Oligonucleotide primers Primer Sequence Amplicon size (bps)
Gene ID Gene

PCHAS-146160 Pc-B-actin I Forward
Reverse
GCAATGTATGTAGCAATTCA
GCATGGGGTAATGCATAACC
131
PCHAS-091340 PcUCH-L5 Forward
Reverse
AAATGCTGAAGCAGATGGGCG
GGTTCTGTCCCCATTTCTGCTT
181
PCHAS-132740 PcUCH-L3 Forward
Reverse
CGGGAAGTGATTTAAATGCAG
GCACTTGTGGTTTGGCCATGG
136
PCHAS-041770 PcUBP8 Forward
Reverse
GGCGGTCGAAATACCTCTAACC
CATCATTACTGTTGGATTGGCTC
127