Optimization of a Loop-Mediated Isothermal Amplification Assay as a Point-of-Care Tool for the Detection of <i>Wuchereria bancrofti</i> in Human Blood in Tana River Delta, Kenya

<table class="table-group" id="tab1"><tr><td><table class="table"><tr><td class="thead-hr" colspan="5"><hr/></td></tr><tr class="thead"><td class="align_left">Target repeat sequence</td><td class="align_center">Amplification assay</td><td class="align_center">Primer position</td><td class="align_center">Sequence (5<svg height="11.4859pt" id="M1" style="vertical-align:-0.04979992pt" version="1.1" viewbox="-0.0498162 -11.4361 3.89517 11.4859" width="3.89517pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.0091,0,0,-0.0091,0,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z"></path></g></svg>……………….3<span class="nowrap"><svg height="11.4859pt" id="M2" style="vertical-align:-0.04979992pt" version="1.1" viewbox="-0.0498162 -11.4361 3.89517 11.4859" width="3.89517pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.0091,0,0,-0.0091,0,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z"></path></g></svg>)</span></td><td class="align_center">Purpose</td></tr><tr><td class="thead-hr" colspan="5"><hr/></td></tr><tr><td class="align_left" rowspan="6">Ssp 1</td><td class="align_center" rowspan="4">LAMP primers</td><td class="align_center">FIP; <svg height="11.8343pt" id="M3" style="vertical-align:-3.30932pt" version="1.1" viewbox="-0.0498162 -8.52498 46.4749 11.8343" width="46.4749pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.013,0,0,-0.013,0,0)"><path d="M493 503C489 551 484 614 483 650H43V622C120 616 128 611 128 525V126C128 40 120 34 40 28V0H312V28C221 34 213 40 213 126V307H316C407 307 412 296 424 227H453V420H424C412 355 407 346 316 346H213V584C213 613 216 616 246 616H322C398 616 419 607 436 579C449 559 455 539 464 499L493 503Z"></path></g><g transform="matrix(.013,0,0,-0.013,6.903,0)"><path d="M384 0V27C293 34 287 42 287 114V635C232 613 172 594 109 583V559L157 557C201 555 205 550 205 499V114C205 42 199 34 109 27V0H384Z"></path></g><g transform="matrix(.0091,0,0,-0.0091,13.143,3.132)"><path d="M614 175C564 76 510 21 408 21C256 21 146 149 146 336C146 488 235 629 402 629C510 629 570 586 597 480L626 488C620 541 614 582 606 638C578 643 510 665 429 665C206 665 44 527 44 316C44 157 153 -15 402 -15C474 -15 558 5 586 11C604 45 629 119 643 165L614 175Z"></path></g><g transform="matrix(.013,0,0,-0.013,22.621,0)"><path d="M535 230V280H323V490H265V280H52V230H265V-3H323V230H535Z"></path></g><g transform="matrix(.013,0,0,-0.013,33.157,0)"><path d="M493 503C489 551 484 614 483 650H43V622C120 616 128 611 128 525V126C128 40 120 34 40 28V0H312V28C221 34 213 40 213 126V307H316C407 307 412 296 424 227H453V420H424C412 355 407 346 316 346H213V584C213 613 216 616 246 616H322C398 616 419 607 436 579C449 559 455 539 464 499L493 503Z"></path></g><g transform="matrix(.013,0,0,-0.013,40.06,0)"><path d="M412 140C382 77 369 73 315 73H129L270 222C362 320 402 379 402 466C402 571 322 635 234 635C177 635 130 609 99 576L42 495L64 475C90 514 133 568 201 568C274 568 318 519 318 435C318 349 255 267 193 193C144 135 87 78 32 23V0H405C417 45 427 89 440 131L412 140Z"></path></g></svg></td><td class="align_center">CGACTGTCTAATCCATTCAGAGTG- TATCTGCCCATAGAAATAACTACG</td><td class="align_center">Forward inner primer</td></tr><tr><td class="align_center">BIP; <svg height="11.8343pt" id="M4" style="vertical-align:-3.30932pt" version="1.1" viewbox="-0.0498162 -8.52498 48.0146 11.8343" width="48.0146pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.013,0,0,-0.013,0,0)"><path d="M372 352C427 368 507 407 507 502C507 548 486 592 451 616C420 638 376 650 301 650H44V622C124 616 128 610 128 527V123C128 40 122 34 36 28V0H257C336 0 402 12 453 40C512 72 548 124 548 191C548 291 471 335 372 350V352ZM213 362V558C213 591 216 602 226 608C235 614 258 618 282 618C377 618 415 558 415 490C415 406 369 362 260 362H213ZM213 328H258C380 328 450 283 450 181C450 76 377 35 296 34C231 34 213 53 213 125V328Z"></path></g><g transform="matrix(.013,0,0,-0.013,7.673,0)"><path d="M384 0V27C293 34 287 42 287 114V635C232 613 172 594 109 583V559L157 557C201 555 205 550 205 499V114C205 42 199 34 109 27V0H384Z"></path></g><g transform="matrix(.0091,0,0,-0.0091,13.913,3.132)"><path d="M614 175C564 76 510 21 408 21C256 21 146 149 146 336C146 488 235 629 402 629C510 629 570 586 597 480L626 488C620 541 614 582 606 638C578 643 510 665 429 665C206 665 44 527 44 316C44 157 153 -15 402 -15C474 -15 558 5 586 11C604 45 629 119 643 165L614 175Z"></path></g><g transform="matrix(.013,0,0,-0.013,23.39,0)"><path d="M535 230V280H323V490H265V280H52V230H265V-3H323V230H535Z"></path></g><g transform="matrix(.013,0,0,-0.013,33.927,0)"><path d="M372 352C427 368 507 407 507 502C507 548 486 592 451 616C420 638 376 650 301 650H44V622C124 616 128 610 128 527V123C128 40 122 34 36 28V0H257C336 0 402 12 453 40C512 72 548 124 548 191C548 291 471 335 372 350V352ZM213 362V558C213 591 216 602 226 608C235 614 258 618 282 618C377 618 415 558 415 490C415 406 369 362 260 362H213ZM213 328H258C380 328 450 283 450 181C450 76 377 35 296 34C231 34 213 53 213 125V328Z"></path></g><g transform="matrix(.013,0,0,-0.013,41.6,0)"><path d="M412 140C382 77 369 73 315 73H129L270 222C362 320 402 379 402 466C402 571 322 635 234 635C177 635 130 609 99 576L42 495L64 475C90 514 133 568 201 568C274 568 318 519 318 435C318 349 255 267 193 193C144 135 87 78 32 23V0H405C417 45 427 89 440 131L412 140Z"></path></g></svg></td><td class="align_center">TCTGTGCTGAATTTTTGTGGATTG-CCAAACTAATTGTAAGCAGTCTT</td><td class="align_center">Reverse inner primer</td></tr><tr><td class="align_center">F3</td><td class="align_center">TTTGATCATCTGGGAACGT</td><td class="align_center">Forward outer primer</td></tr><tr><td class="align_center">B3</td><td class="align_center">AAGCACCTTAAATCTGTCAAT</td><td class="align_center">Reverse outer primer</td></tr><tr><td class="align_center" rowspan="2">PCR primers</td><td class="align_center">NV-1</td><td class="align_center">5<span class="nowrap"><svg height="11.4859pt" id="M5" style="vertical-align:-0.04979992pt" version="1.1" viewbox="-0.0498162 -11.4361 3.89517 11.4859" width="3.89517pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.0091,0,0,-0.0091,0,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z"></path></g></svg>-</span>CGTGATGGCATCAAAGTAGCG-3<span class="nowrap"><svg height="11.4859pt" id="M6" style="vertical-align:-0.04979992pt" version="1.1" viewbox="-0.0498162 -11.4361 3.89517 11.4859" width="3.89517pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.0091,0,0,-0.0091,0,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z"></path></g></svg>;</span></td><td class="align_center">Forward primer</td></tr><tr><td class="align_center">NV-2</td><td class="align_center">5<span class="nowrap"><svg height="11.4859pt" id="M7" style="vertical-align:-0.04979992pt" version="1.1" viewbox="-0.0498162 -11.4361 3.89517 11.4859" width="3.89517pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.0091,0,0,-0.0091,0,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z"></path></g></svg>-</span>CCCTCACTTACCATAAGACAAC-3<span class="nowrap"><svg height="11.4859pt" id="M8" style="vertical-align:-0.04979992pt" version="1.1" viewbox="-0.0498162 -11.4361 3.89517 11.4859" width="3.89517pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.0091,0,0,-0.0091,0,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z"></path></g></svg>.</span></td><td class="align_center">Reverse primer</td></tr><tr class="table-tr"><td colspan="5"><hr class="tbody-hr"/></td></tr></table></td></tr></table>

<div>LAMP and PCR primer sets used for the detection of <i>W. bancrofti</i> in this study.</div>

Journal of Parasitology Research

tab1

Table 1

Table 1: Optimization of a Loop-Mediated Isothermal Amplification Assay as a Point-of-Care Tool for the Detection of <i>Wuchereria bancrofti</i> in Human Blood in Tana River Delta, Kenya 

Table 1 | Optimization of a Loop-Mediated Isothermal Amplification Assay as a Point-of-Care Tool for the Detection of Wuchereria bancrofti in Human Blood in Tana River Delta, Kenya 