Signal Transduction in Astrocytes during Chronic or Acute Treatment with Drugs (SSRIs, Antibipolar Drugs, GABA-ergic Drugs, and Benzodiazepines) Ameliorating Mood Disorders
Figure 8
(a1) Effects of chronic treatment with different concentrations of lithium on intracellular pH measured as a function of the length of the treatment and the lithium concentration (diamonds: control; circles 0.5 mM Li+; triangles 1 mM Li+; or squares 2 mM Li+). (a2) mRNA expression of NHE1 in control cultures (white); cultures treated with 0.5 mM Li+ (light gray); 1 mM Li+ (darker gray) or 2 mM Li+ (black). *indicates statistically significant difference ( from control cultures and cultures treated with 0.5 mm Li+ for the same length of time. (b) mRNA expression of the acid extruders NBCe1 and NHE1 in astrocytes and neurons from astrocytes, obtained from untreated animals or animals treated for 14 days with carbamazepine (CBZ). In both cases, astrocytes had been stained with GFP and neurons with YPHF in transgenic animals, and they were separated after cell dissociation by means of the different fluorescent signals. The size of the PCR products of NBCe1 is 298 bp, of NHE1 is 422 bp, and of TBP is 236 bp. The primers for NBCe1 were (FWD) 5′CTCACTTCTCCTGTGCTTGCCT3′ and (REV) 5′GTGGTTGGAAAATAGCGGCTGG3′, and those for NHE1 and TBP the same as used by Song et al. [85]. (a1) and (a2) from Song et al. [86], ((b1) and (b2)) Unpublished experiments by B. Li, D. Song, and L. Peng, using methodology similar to that used by Li et al. [22].