Journal of Toxicology / 2017 / Article / Tab 1

Research Article

Optimization of Aflatoxin B1 Aptasensing

Table 1

Sequences of oligonucleotides used in this study. ssDNA: single stranded DNA; B: blocker complementary sequence.

ssDNASequences (5′-3′)

DNAzyme-aptamerTGGGTAGGGCGGGTTGGGAAAGTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCAC
Aptamer-DNAzymeGTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACAAATGGGTAGGGCGGGTTGGG
B1CACGTGCCCAACAAATCCCAACCC
B2CTGACAGAGAGAAACCACGTGCCCAACAAATCCCAACCC
B3GAGAGACAACACGTGCCCAACAAATCCCAACCCGCC