Leukemia Research and Treatment / 2013 / Article / Tab 1

Research Article

New Quantitative Method to Identify NPM1 Mutations in Acute Myeloid Leukaemia

Table 1

Sequences of the different primers and probes.

Gene analysisMutations (nucleotides insertion)PrimerSequenceReference

NPM1
HRM analysis
NPM-S (F)5′ TGGTTCCTTAACCACATTTCTTT 3′[18]
NPM-AS (R)5′ GGACAACACATTCTTGGC 3′

NPM1
ASO-RQ-PCR
c-NPMl-F (F)5′ GAAGAATTGCTTCCGGATGACT 3′[11]
A (tag)c-NPM-mut A-R (R)5′ CTTCCTCCACTGCCAGACAGA 3′[11]
B (catg)c-NPM-mut B-R (R)5′ TTCCTCCACTGCCATGCAG 3′[11]
C (cctg)c-NPM-mut C-R (R)5′ TTCCTCCACTGCCACGCAG 3′[12]*
D (cctg)c-NPM-mut D-R (R)5′ TTCCTCCACTGCCAGGCAG 3′[12]*
P (cttg)c-NPM-mut P-R (R)5′ TTCCTCCACTGCCAAGCA 3′[12]*
NPM1 Detection Probe5′ Fam-ACCAAGAGGCTATTCAA-MGB 3′[11]

ABL
ASO-RQ-PCR
ENF1003 (F)5′ TGGAGATAACACTCTAAGCATAACTAAAGGT 3′[19]
ENR1063 (R)5′ GATGTAGTTGCTTGGGACCCA 3′[19]
ENPrl043 detection probe5′ Fam-CCATTTTTGGTTTGGGCTTCACACCATT-Tamra 3′[19]

F: forward primer; R: reverse primer; specific mutation primers were designed based on mutations previously described by Schnittger et al. [12].

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.