Mediators of Inflammation / 2012 / Article / Tab 1

Research Article

Adipose Tissue-Specific Deletion of 12/15-Lipoxygenase Protects Mice from the Consequences of a High-Fat Diet

Table 1

Primer sequences used in SYBR-based real-time RT-PCR amplification of mouse cDNA.

Mouse genesForward primer (5′–3′)Reverse primer (5′–3′)

12/15-LOctctcaaggcctgttcaggagtccattgtccccagaacct
Actinaggtcatcactattggcaacgacacttcatgatggaattgaatgtagtt
Adiponectingttgcaagctctcctgttccatccaacctgcacaagttcc
CD11cctgagagcccagacgaagacatgagctgcccacgataagag
Collagen 6 alpha 1gatgagggtgaagtgggagacagcacgaagaggatgtcaa
F4/80ctttggctatgggcttccagtcgcaaggaggacagagtttatcgtg
IL-6gaggataccactcccaacagaccaagtgcatcatcgttgttcataca
MCP-1cttctgggcctgctgttcaccagcctactcattgggatca
Twist-1cgcacgcagtcgctgaacggacgcggacatggaccagg