Mediators of Inflammation / 2013 / Article / Tab 1

Research Article

IRAK1/4-Targeted Anti-Inflammatory Action of Caffeic Acid

Table 1

Primer sequences used in RT-PCR analysis.

NameSequence (5′ to 3′)

Real-time PCR
 iNOS FGGA GCC TTT AGA CCT CAA CAG A
RTGA ACG AGG AGG GTG GTG
 COX-2 FCAC TAC ATC CTG ACC CAC TT
RATG CTC CTG CTT GAG TAT GT
 TNF- FTGC CTA TGT CTC AGC CTC TT
RGAG GCC ATT TGG GAA CTT CT
 GAPDHFCAA TGA ATA CGG CTA CAG CAA C
RAGG GAG ATG CTC AGT GTT GG

Semiquantitative PCR
 iNOS FCCCTTCCGAAGTTTCTGGCAGCAG
RGGCTGTCAGAGCCTCGTGGCTTTGG
 IL-12 FGCGGGTCTGGTTTGATGA
RTGAACTGGCGTTGGAAGC
 COX-2 FCACTACATCCTGACCCACTT
RATGCTCCTGCTTGAGTATGT
 GAPDHFCACTCACGGCAAATTCAACGGCA
RGACTCCACGACATACTCAGCAC

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19.