Mediators of Inflammation / 2015 / Article / Tab 1

Research Article

Polymorphisms of Tumor Necrosis Factor Alpha in Moroccan Patients with Gastric Pathology: New Single-Nucleotide Polymorphisms in TNF-α−193 (G/A)

Table 1

Technical data for the analysis of TNF- polymorphisms.

GeneLocationPrimer pairs usedSize of fragments

TNF-PromoterF: 5′-(−372) GAAGGAAACAGACCACAGAC3′-(−353) 266 bp
R: 5′-(−106) ATCTGGAGGAAGCGGTAGTG3′-(−128)