Construction, Expression, and Characterization of a Recombinant Immunotoxin Targeting EpCAM

Table 1

Sequences of the primers used in this study are listed as A to L.

Primers	Sequence
A	tgaggagacggtgaccgtggtcccttggccccag
B	aggtsmarctgcagsagtcwgg
C	gttagatctccagcttggtccc
D	gacattcagctgacccagtctcca
E	gcggatccgaggtgaagctrcagcagt
F	cggtcgactgaggagacrgtgaccgtkg
G	cggtcgacggtggtggtggttctggtggtggtggttctggtggtggtggttctgatgttgtgctgacccagtctccactcactttgt
H	gcaagcttgatctccagcttggtccctcc
I	gcgaattcggtggtggtggttctggtggtggtggttctggtggtggtggttctgcggccgcttctggaggt
J	cgctcgagtcacagttcgtctttcggcggtttg
K	gcggtacccaggaagaatgtgtctgtg
L	cgaagcttaccagcttttagaccctg

B and F were degenerate primers; the degenerate base codes are as follows: s:c/g; m:a/c; r:a/g; w:a/t; k:g/t.