Research Article
FCGR2A Promoter Methylation and Risks for Intravenous Immunoglobulin Treatment Responses in Kawasaki Disease
Table 2
Means and standard deviations of the percentage of methylation detected at each CpG site in KD patients and normal controls.
| Gene | CpG sites | Methylation (%) | value | KD patients () | Control subjects () | Mean | SD | 95% CI | Mean | SD | 95% CI |
| FCGR2A | A | 80.61 | 5.06 | 78.90–82.33 | 78.92 | 4.42 | 77.05–80.78 | 0.1856 | B | 62.75 | 9.51 | 59.54–65.97 | 62.31 | 5.13 | 60.15–64.48 | 0.8372 | C | 70.16 | 5.61 | 68.26–72.06 | 70.22 | 6.26 | 67.57–72.86 | 0.9711 | D | 67.82 | 5.10 | 66.10–69.55 | 66.49 | 4.69 | 64.51–68.47 | 0.3112 | E | 61.51 | 5.87 | 59.52–63.49 | 59.84 | 3.57 | 58.33–61.35 | 0.2175 | F | 82.16 | 7.24 | 79.71–84.61 | 80.24 | 5.87 | 77.76–82.72 | 0.2852 | G | 68.66 | 5.43 | 66.82–70.49 | 64.36 | 5.35 | 62.10–66.62 | 0.0038** | H | 43.19 | 11.83 | 39.19–47.20 | 34.92 | 4.55 | 33.00–36.84 | 0.0019** | I | 83.74 | 5.75 | 81.79–85.68 | 86.56 | 6.73 | 83.72–89.40 | 0.0874 | J | 62.30 | 8.20 | 59.52–65.07 | 55.12 | 4.98 | 53.01–57.22 | 0.0003*** | K | 67.54 | 7.19 | 65.11–69.98 | 66.86 | 5.51 | 64.53–69.18 | 0.6982 |
|
|
The statistical significance , . TGCAAGCTCTGCCTCCCGAGGTTCACGBCCATTCTCCTGCCTCAGCCTCCCGCAGTAGCTGGGACTATCTGCCACCGDCGECCCGF GCTAAATTTTTTTTGTATTATTAGTAGAGACGGGGGTTTCACCGHTGTTAGCCAGGATGGTCTCGIATCTCCTGACCTCGJTGATCCACCCGK CCTTGGCCTCCCAAAG.
|