Mediators of Inflammation / 2015 / Article / Tab 1

Research Article

Gestation Related Gene Expression of the Endocannabinoid Pathway in Rat Placenta

Table 1

Primer sequences (forward and reverse) and product lengths for all genes used in qPCR experiments.

Gene Product Forward primer Reverse primer

Ptgs2 201 bp TCACCCGAGGACTGGGCCAT CAGCGAACCGCAGGTGCTCA
Mgll 240 bp CGCGCAGTAGTCTGGCTCT AAGATGAGGGCCTTGGGTGTG
Plcd4 182 bp CTTCCAGTCGTCAGACTACCC CCAAGATCTTCCCCCGAAGC
Faah 218 bp CAACCGCCTCAGCAAGAGTG CATAGTACCCCACACGCAGG
Dagla 121 bp CTTGGACTCAGCCCTGGAC GAACTGGGATGAAGGGGGTG
Nat1 240 bp TCACTCGCCATGGCATTCTC AGCCTGGCTTGCTTTTACCT
Pld1 224 bp CCCCCATCTCGACTTTCAACT TCCCGGGTGTCGAGATTTTC
Ptgs1 145 bp TAGGCCATGGGGTAGACCTT TTCACGGACGCCTGTTCTAC
-actin 119 bp TCCACCCGCGAGTACAACCT TTGCACATGCCGGAGCCGTT