Table 1: Primers used in real-time PCR analyses of mRNA expression.

GenePrimers(5′-3′ sequence)GenBank accession numberProduct size (bp)

IL-1βForward
Reverse
CACTACAGGCTCCGAGATGA
CGTTGCTTGGTTCTCCTTGT
NM_008361143

IL-4Forward
Reverse
TCCGTGCTTGAAGAAGAACTC
GTGATGTGGACTTGGACTCATT
NM_021283.2116

IL-6Forward
Reverse
AGGACCAAGACCATCCAATTCA
GCTTAGGCATAACGCACTAGG
NM_031168.197

IL-13Forward
Reverse
GCTCCAGCATTGAAGCAGTG
CGTGGCAGACAGGAGTGTT
NM_008355.3141

TNF-αForward
Reverse
GCACCACCATCAAGGACTC
AGGCAACCTGACCACTCTC
NM_01369396

MCP-1Forward
Reverse
TTCCACAACCACCTCAAGCA
TTAAGGCATCACAGTCCGAGTC
NM_01133380

CCL5Forward
Reverse
CGAAGGAACCGCCAAGTGT
AGGACTAGAGCAAGCAATGAC
NM_013653.3139

CCL11Forward
Reverse
GGCTTCATGTAGTTCCAGAT
CCATTGTGTTCCTCAATAATCC
NM_011330.3145

CCL24Forward
Reverse
AGGCAGTGAGAACCAAGT
GCGTCAATACCTATGTCCAA
NM_019577.4102

iNOSForward
Reverse
TTCCACAACCACCTCAAGCA
TTAAGGCATCACAGTCCGAGTC
NM_01092783

COX-2Forward
Reverse
ACCAGCAGTTCCAGTATCAGA
CAGGAGGATGGAGTTGTTGTAG
NM_011198143

ICAM-1Forward
Reverse
AACAGAATGGTAGACAGCAT
TCCACCGAGTCCTCTTAG
NM_010493.2113

β-actinForward
Reverse
AAGACCTCTATGCCAACACAGT
AGCCAGAGCAGTAATCTCCTTC
NM_007393.392