Mediators of Inflammation / 2016 / Article / Tab 1

Research Article

Insights from lncRNAs Profiling of MIN6 Beta Cells Undergoing Inflammation

Table 1

Primers used for RT-qPCR analysis.

Primer namePrimer sequence (5′-3′) forwardPrimer sequence (5′-3′) reverse

NONMMUT036704CTGAATGGGTGGTGAGTGTGGCTCTCTGGCAACAGGAAAG
NONMMUT009926CACACCAGAAGAGGTCGTCAGGCTCAATGGGTAAGAGCAC
NONMMUT034373GGCTCTCAGCTCTTGTCTGGAGCATGGCCTTTGACCTCTA
NONMMUT039557GCTCACCACTCCTCTCTTCCAAGAATGCAGGCAAACCCTA
NONMMUT024067TCCAGAGATGATGGGTCCTTACAGTCCAGAGAGGCAGACC
NONMMUT029240AAGAAACCTGCCACACTGCTCGAAGACTCACCATCCACCT
NONMMUT029347GTTTCCACCCATGTTGTGCGCCTTTCTCCTACACCACCA
NONMMUT027853CAATCAGGAGGGATCTTCCAACACGGAGCAGAAAGAGGAG
NONMMUT014853GAGGCATCTGCTTGACTGTGTTCGTGCTATGCTCACTGCT
NONMMUT056688GCCCTGATACTGAGGAGTGGTTTGTGCAGGAAGGGAAATC
NONMMUT065500GGGAGAGGAAGGAGGTGTTCAGGACCGCATACTCAGGAGA
NONMMUT037939GATGAAGAAGCTGGACCTCAAGGACGTTTGGAGGAAGGAAT
NONMMUT034526GGATGAAGGGATTGCTGATTGCTGTCTTCCTGGCATTTCT
NONMMUT029257CCTCTATCCACCGACTCCAACACGCTGTGTTTCTCCTCCT
NONMMUT005834CATAGATGGCACATGGGAAGATCTCACCTCTGGCACACAC
-actinAGAGGGAAATCGTGCGTGACCCATACCCAAGAAGGAAGGCT

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.