Research Article

Visfatin Triggers Anorexia and Body Weight Loss through Regulating the Inflammatory Response in the Hypothalamic Microglia

Table 1

Sequences of mouse primers used for qRT-PCR analysis.

GeneForward primer sequenceReverse primer sequence

MCP-1AACTGCATCTGCCCTAAGGTAGTGCTTGAGGTGGTTGTGGAA
TNF-αTGGGACAGTGACCTGGACTGTTTCGGAAAGCCCATTTGAGT
IL-6CCACTTCACAAGTCGGAGGCTTAGCAAGTGCATCATCGTTGTTCATAC
IL-1βAGGGCTGCTTCCAAACCTTTGACATACTGCCTGCCTGAAGCTCTTGT
β-ActinTGGAATCCTGTGGCATCCATGAAACTAAAACGCAGCTCAGTAACAGTAACAGTCCG