Mediators of Inflammation / 2017 / Article / Tab 1

Research Article

Cannabinoid Receptor 2 Modulates Neutrophil Recruitment in a Murine Model of Endotoxemia

Table 1

Primers used for detection of proinflammatory mediator expression in murine lungs.

GenePrimerPrimer sequence (5 → 3)

Mm_Ccl2SenseCAGCACCTTTGAATGTGAAGTTG
AntisenseTGCTTGAGGTGGTTGTGGAA
Mm_Cxcl1SenseAAGTCATAGCCACACTCAAG
AntisenseCAGACAGGTGCCATCAGA
Mm_Actg1SenseCCAACAGCAGACTTCCAGGATT
AntisenseCTGGCAAGAAGGAGTGGTAACTG