Mediators of Inflammation / 2017 / Article / Tab 2

Research Article

Associations of Functional MicroRNA Binding Site Polymorphisms in IL23/Th17 Inflammatory Pathway Genes with Gastric Cancer Risk

Table 2

PCR information and restriction enzymes used for genotyping of the four miRNA binding site SNPs.

GeneSNP IDAllelesAnnealing Tm (°C)Restriction enzymeGenotype (bp)Primers

IL17Ars3748067C/T58.2ApoIC: 317Sense AGGATGGAGTGAAGAGGAA
T: 202,115Antisense AGAGATCAACAGACCAACAT
IL23Rrs10889677A/C56.6MnlIA: 165Sense TGCTCCTACCATCACCAT
C: 86,79Antisense TGAGGCGTCCACATAATG
IL17RArs1468488T/C59.6AluIT: 164,94,92Sense GGAGGAAGAGGAGGAAGAG
C: 256,94Antisense GGATAGACGATAACCAGACC
IL17RArs887796A/G56.6BanIA: 454Sense AATTCTCCAAGGTGTCTGTT
G: 263,191Antisense GATCAAGATAGTAGGCAGGAA

SNP: single-nucleotide polymorphism.

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.