Table 1: Primer and probe sequences for RT-PCR.

TargetPrimersProbe

β-Actin5′TGACAGGATGCAGAAGGAGA
3′CGCTCAGGAGGAGCAATG
a106
mGBP15′CAGACTCCTGGAAAGGGACTC
3′CTTGGACCTGGAACATTCACTGAC
a41
mGBP25′TGAGTACCTGGAACATTCACTGAC
3′AGTCGCGGCTCATTAAAGC
a17
mGBP35′GGCTGAGGACTGTCCCTGT
3′CATGGTCCACTCGGAAGC
a21
mBGP45′GCCAAGATCAAGACCCTCAG
3′CCACGTAGGTTGTCACCAGA
a48
mGBP55′TCACTGAAGCTGAAGCAAGG
3′GCGTCAAAAACAAAGCATTTC
a48
mGBP65′ATATTTCAACATTTTTTGTTCCTTGT
3′GAAATGGGAGAAAAAATAAATGAAGC
FAM-AGTCATGTTCAATCTTCTCCCTCTTGTCC-DB
mGBP75′GCAGAGAATCCGGTGCAG
3′TTTCCACTAGGCACACAGGA
a93
mGBP85′AAGAAGCTGAAGGAACAAAAGGC
3′GAAATGGGAGAAAAAATAAATGAAGC
FAM-TGTTTCAGTTGCTGTATCTCTCCGTCCA-TMR
mGBP95′TTCCAAAACTTTCTCCAGTCACAGTA
3′GGCACGCTCCTCTGCAA
FAM-CCAGCAGTGAGGGCTCTATCTGCCT-TMR
GTPBP15′GGTGCAGAGCAAAGATGATG
3′ATCTGGAATATCGGGCACAT
a75
IL-45′CATCGGCATTTTGAACGAG
3′CGAGCTCACTCTCTGTGGTG
a2
IL-12p405′GATTCAGACTCCAGGGGACA
3′TGGTTAGCTTCTGAGGACACATC
a27
iNOS5′CTTTGCCACGGACGAGAC
3′TCATTGTACTCTGAGGGCTGAC
a13
LTα5′TCCCTCAGAAGCACTTGACC
3′GAGTTCTGCTTGCTGGGGTA
a62
LTβ5′CCTGGTGACCCTGTTGTTG
3′TGCTCCTGAGCCAATGATCT
a76
IFNβ5′CAGGCAACCTTTAAGCATCAG
3′CCTTTGACCTTTCAAATGCAG
a95

aNumbers identify probes obtained from the Roche Universal ProbeLibrary (Roche).