Table 1: The primer sequence for RT-PCR.

GenePrimer sequence (5→3)

TLR4ForwardTGACAGGAAACCCTATCCAGAGTT
(Human)ReverseTCTCCACAGCCACCAGATTCT
TLR4ForwardTACAGTTCGTCATGCTTTCTC
(Rat)ReverseATTAGGAAGTACCTCTATGCAG
ZO-1ForwardGCAGCCACAACCAATTCATAG
(Human)ReverseGCAGACGATGTTCATAGTTTC
ZO-1ForwardGCTCACCAGGGTCAAAATGT
(Rat)ReverseGGCTTAAAGCTGGCAGTGTC
OccludinForwardACCCCCATCTGACTATGTGGAA
(Human)ReverseAGGAACCGGCGTGGATTTA
OccludinForwardTTACGGCTATGGAGGGTACAC
(Rat)ReverseGACGCTGGTAACAAAGATCAC
GAPDHForwardACCACAGTCCATGCCATCAC
(Human)ReverseTCCACCACCCTGTTGCTGTA
GAPDHForwardGGCACAGTCAAGGCTGAGAATG
(Rat)ReverseATGGTGGTGAAGACGCCAGTA