Mediators of Inflammation / 2020 / Article / Tab 1

Research Article

Diallyl Disulfide Suppresses Inflammatory and Oxidative Machineries following Carrageenan Injection-Induced Paw Edema in Mice

Table 1

Primer sequences of genes analyzed in real time PCR.

NameAccession numberSense (5—3)Antisense (5—3)

GapdhNM_001289726.1CCCATCACCATCTTCCAGGAGCCCAGTGAGCTTCCCGTTCAGC
Ccl2NM_011333.3GCAGCAGGTGTCCCAAAGAAATTTACGGGTCAACTTCACATTCAA
Il2NM_008366.3TGAGTCAGCAACTGTGGTGGGCCCTTGGGGCTTACAAAAAG
Il10NM_010548.2ATAACTGCACCCACTTCCCAGGGCATCACTTCTACCAGGT
Il1bNM_008361.4CCTTCCAGGATGAGGACATGATGAGTCACAGAGGATGGGCTC
Nos2NM_001313922.1CGAAACGCTTCACTTCCAATGAGCCTATATTGCTGTGGCT
Ptgs2NM_011198.4CAGACAACATAAACTGCGCCTTGATACACCTCTCCACCAATGACC
TnfαNM_001278601.1ACCCTCACACTCACAAACCAACCCTGAGCCATAATCCCCT

The abbreviations of the genes: Gapdh: glyceraldehyde-3-phosphate dehydrogenase; Ptgs2: prostaglandin-endoperoxide synthase 2 (COX-2); Nos2: nitric oxide synthase 2, inducible; Il1b: interleukin 1 beta; Tnfα: tumor necrosis factor alpha; Ccl2: chemokine (C-C motif) ligand 2 (MCP-1).

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.