Neural Plasticity / 2021 / Article / Tab 1

Research Article

Transcriptomic Analysis Reveals an Altered Hcy Metabolism in the Stria Vascularis of the Pendred Syndrome Mouse Model

Table 1

Primer used in this study.

TargetForward (5’to3’)Reversed (5’to 3’)

Slc26a7GCATGATGAAACCTCGCAACATTCATTGCAGTTGCCGTTGG
Ace2CACTCCTGCCACACCACGTTTGGTCTTTAGGTCAAGTTTACAGCC
Gpr176GGTGTTATGGTCAACTTGCCGAGAGCATCGTATAGATCCACCAG
Lrrc8dATGTTTACCCTTGCGGAAGTTGCATCAGCATAACGACTGCCAG
Padi1TGTGTGCGTGGTAGGTGTGTCGAGGGATCGTAGACCATGT
Arrb1AAGGGACACGAGTGTTCAAGACCCGCTTTCCCAGGTAGAC
Alox15CAGGGATCGGAGTACACGTTGATTGTGCCATCCTTCCAGT
BmhtCTGGGGAAGTGGTTTGGACAGCCGGAAGCTATTCGCAGAT
Bhmt2CTCCAGAAGCAGTGGTAGAACATCCATCAGCTCCCGCTCTCAAG
AhcyTCGAAGTGTCCAATGTTACAGACCTTGGCCGGCACTTTGAG
CbsGCAGCGCTGTGTGGTCATCGTCACTCAGGAACTTGGACATGTAGT

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.