Table 1: Gene primers used in this study.

GeneForward primer (5′-3′)Reverse primer (5′-3′)

hPGC1 GGAACTGCAGGCCTAACTCCCACTGTCCCTCAGTTCACCG
hNRF-1CCAGTGGCCACACAGAACTCCTTCCTTTCCCTTCCACTGC
hTfamATGCTTATAGGGCGGAGTGGTGGTTTCCTGTGCCTATCCA
hHO-1GGAACTTTCAGAAGGGCCAGGTCCTTGGTGTCATGGGTCA
hGAPDHGGGGCTCTCCAGAACATCATTCAAGGGGTCTACATGGCAA
mPGC-1 GGAACTGCAGGCCTAACTCCTTGGAGCTGTTTTCTGGTGC
mNRF-1CTCCAAACCCAACCCTGTCTTGGTGGCCTGAGTTTGTGTT
mTfamCAGCCAGGTCCAGCTCACTAATTAGGAGGGTCTCGCTCCA
mTNF- AGACCCTCACACTCAGATCATCTTCTTGCTACGACGTGGGCTACA
mIL-1 TCGCTCAGGGTCACAAGAAAATCAGAGGCAAGGAGGAAACAC
mIL-6CCAGAGATACAAAGAAATGATGGACTCCAGAAGACCAGAGGAAAT
m18SCAGTGAAACTGCGAATGGCTTGCCTTCCTTGGATGTGGTA