Oxidative Medicine and Cellular Longevity / 2018 / Article / Tab 1

Research Article

Low-Frequency Intermittent Hypoxia Promotes Subcutaneous Adipogenic Differentiation

Table 1

Primer sequences used in this study.

Gene namesForward primer (5–3)Reverse primer (5–3)

hFABP4GAAGTAGGAGTGGGCTTTGCATTCCTGGCCCAGTATGAAG
hGLUT4GATAGGCTCCGAAGATGGGCCAGCCACGTCTCATTGTAG
hCEBPδCAGAAGTTGGTGGAGCTGTCTTACCGGCAGTCTGCTGTC
hCEBPαCAAGAAGTCGGTGGACAAGAGGTCATTGTCACTGGTCAGC
hGAPDHGTCAAGGCTGAGAACGGGAAAAATGAGCCCCAGCCTTCTC
Rat FABP4AAATGAGCCCCAGCCTTCTCTGCAAATTTCAGTCCAGGGC
Rat CEBPαGGCCAAGAAGTCGGTGGATTGACCAAGGAGCTCTCAGG
Rat GLUT4GCCATCGTCATTGGCATTCTCGCTTTAGACTCTTTCGGGC
Rat PPARγAGGGGATCTTGACAGGAAACGAAACTGGCACCCTTGAAA
Rat GAPDHTCATCAACGGGAAACCCATCACACGCCAGTAGACTCCACGACA