Research Article
Protective Effects of Inorganic and Organic Selenium on Heat Stress in Bovine Mammary Epithelial Cells
Table 1
Sequences of primers used in real-time PCR.
| Gene | Forward (5-3) | Reverse (5-3) | GenBank accession # of mRNA |
| RPS9 | cctcgaccaagagctgaag | cctccagacctcacgtttgttc | NM_001101152.2 | UXT | tgtggcccttggatatggtt | ggttgtcgctgagctctgtg | NM_001037471.2 | GAPDH | tggaaaggccatcaccatct | cccacttgatgttggcag | NM_001034034.2 | BAX | tggacattggacttccttcg | ccagccacaaagatggtcac | NM_173894.1 | BCL2 | ggggtcatgtgtgtggagag | tccacaaaggcgtcccag | NM_001166486 | HSF1 | tgcagctgatgaaggggaag | actggatgagcttgttgacga | NM_001076809.1 | HSP90 | ccaagtctggcactaaag | gaagactcccaagcatac | NM_001079637.1 | Nrf2 | aaccaccctgaaagcacaac | ttgggacccttctgtttgac | NM_001011678.2 | TXNRD1 | gtgttcacgactctgtcggt | ctgccttccacgaatcacct | NM_174625.4 | HO-1 | atcgaccccacacctacaca | gacgccatcaccagcttaaaa | NM_001014912 | iNOS | tcaacaaagccctgagcagta | ggaaaactccgaggtgctct | NM_001076799.1 | MCP | cgctcagccagatgcaatta | cccatttctgcttggggtct | NM_174006.2 | IL-8 | ttgtgaagagagctgagaagca | acccacacagaacatgaggc | NM_173925.2 | IL-10 | ctttaagggttacctgggttgc | gccttgctcttgttttcgca | NM_174088.1 |
|
|