Table 3: Primers used in qPCR.

RNA targetProduct companyPrimer sequencesAmplicon length (base pairs)Function related to oxidative stress
(references)

mRNA NRF2SigmaForward:
5-CAATGAGGTTTCTTCGGCTACG-3
Reverse:
5-AAGACTGGGCTCTCGATGTG-3
72Major redox response regulator [1]
mRNA NRF1SigmaForward:
5-ATGGAAATGCAGGCCATGGAAG-3
Reverse:
5-GAGGGGCACTGTACAGGATTT-3
61Redox response regulator [5]
GAPDHSigmaForward:
5-TGGAAGGACTCATGACCACA-3
Reverse:
5-CCATCACGCCACAGTTT-3
miR-23B-3pQiagen5AUCACAUUGCCAGGGAUUACCPredicted NRF2 inhibition [40]
miR-93-5pQiagen5CAAAGUGCUGUUCGUGCAGGUAGPredicted NRF2 inhibition [40]
miR-144-3pQiagen5UACAGUAUAGAUGAUGUACUPredicted NRF2 inhibition [8, 40, 52]
miR-212-3pQiagen5UAACAGUCUCCAGUCACGGCCNRF1 and NRF2 inhibition, interaction with Mn-SOD
miR-340-3pQiagen5UCCGUCUCAGUUACUUUAUAGCMAPK signalling, predicted NRF1 inhibition [40]
miR-383-5pQiagen5AGAUCAGAAGGUGAUUGUGGCUNo predicted inhibition of NRF1/NRF2
miR-510-5pQiagen5UACUCAGGAGAGUGGCAAUCACNo predicted inhibition of NRF1/NRF2
RNU-6BQiagen(Not reported, product no. 218300 cat. no. MS00014000)