Oxidative Medicine and Cellular Longevity / 2019 / Article / Tab 1

Research Article

The Ameliorative Effects of the Ethyl Acetate Extract of Salicornia europaea L. and Its Bioactive Candidate, Irilin B, on LPS-Induced Microglial Inflammation and MPTP-Intoxicated PD-Like Mouse Model

Table 1

The mRNA primers used are the following. Accession numbers of the gene bank are specified, and expected product sizes are listed.

Target geneSequence (5->3)Accession no.Product size (bp)

iNOSForwardTGAAGAAAACCCCTTGTGCTNM_010927100
ReverseTTCTGTGCTGTCCCAGTGAG

COX2ForwardCAAGACAGATCATAAGCGAGGANM_011198107
ReverseGGCGCAGTTTATGTTGTCTGT

TNF-αForwardCCACCACGCTCTTCTGTCTACNM_013693103
ReverseAGGGTCTGGGCCATAGAACT

IL-1βForwardTGTGAAATGCCACCTTTTGANM_00836194
ReverseGGTCAAAGGTTTGGAAGCAG

IL-6ForwardTGATGCACTTGCAGAAAACANM_031168109
ReverseACCAGAGGAAATTTTCAATAGGC

GAPDHForwardAAGGGCTCATGACCACAGTCNM_001289726160
ReverseTTCAGCTCTGGGATGACCTT