Oxidative Medicine and Cellular Longevity / 2020 / Article / Tab 1

Research Article

Tribulus terrestris Ameliorates Oxidative Stress-Induced ARPE-19 Cell Injury through the PI3K/Akt-Nrf2 Signaling Pathway

Table 1

The primer sequences for real-time quantitative PCR.

Gene namePrimer sequences
Forward (5-3)Reverse (5-3)

NRF2TTCTCCCAATTCAGCCAGCCACGTAGCCGAAGAAACCTCAT
CATACTGTTGCTGGAGAATCGGGAGGACGTAGGCTCCAGAAGT
SOD1TGAAGGTGTGGGGAAGCATTAGTCTCCAACATGCCTCTCTTC
SOD2GCATCAGCGGTAGCACCATGGGCTGTAACATCTCCCTTG
GST-piAGACCAGATCTCCTTCGCTGAGGTTCACGTACTCAGGGGA
HO-1ACTGCGTTCCTGCTCAACATGGGCAGAATCTTGCACTTTGTT
NQO1GGTTTGGAGTCCCTGCCATTCCTTCTTACTCCGGAAGGGTC
GCLMCAGCGAGGAGGAGTTTCCAGGAACAGGCCATGTCAACTGC
ACTBCATGTACGTTGCTATCCAGGCCTCCTTAATGTCACGCACGAT

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.