Oxidative Medicine and Cellular Longevity / 2020 / Article / Tab 2

Research Article

Curcumin Attenuates Chronic Unpredictable Mild Stress-Induced Depressive-Like Behaviors via Restoring Changes in Oxidative Stress and the Activation of Nrf2 Signaling Pathway in Rats

Table 2

Primers used in real-time PCR analyses of mRNA expression.

GeneSense primer (5-3)Antisense primer (5-3)

HO-1TGCTCGCATGAACACTCTGGAGATATGGCATAAATTCCCACTGCCACG
NQO-1GTGAGAAGAGCCCTGATTGTCCTGTGATGTCGTTTCTGGA
Nrf2CCCAGCACATCCAGACAGTATCCAGGGCAAGCGACT
β-ActinCATCCTGCGTCTGGACCTGGTAATGTCACGCACGATTTCC

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.