Oxidative Medicine and Cellular Longevity / 2020 / Article / Tab 2

Research Article

Curcumin Attenuates Chronic Unpredictable Mild Stress-Induced Depressive-Like Behaviors via Restoring Changes in Oxidative Stress and the Activation of Nrf2 Signaling Pathway in Rats

Table 2

Primers used in real-time PCR analyses of mRNA expression.

GeneSense primer (5-3)Antisense primer (5-3)

HO-1TGCTCGCATGAACACTCTGGAGATATGGCATAAATTCCCACTGCCACG
NQO-1GTGAGAAGAGCCCTGATTGTCCTGTGATGTCGTTTCTGGA
Nrf2CCCAGCACATCCAGACAGTATCCAGGGCAAGCGACT
β-ActinCATCCTGCGTCTGGACCTGGTAATGTCACGCACGATTTCC

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.