Oxidative Medicine and Cellular Longevity / 2020 / Article / Tab 3

Research Article

The Effects and Mechanism of Quercetin Dietary Supplementation in Streptozotocin-Induced Hyperglycemic Arbor Acre Broilers

Table 3

Primers of genes related to the insulin signaling pathway used for mRNA expression level.

NamePrimer (5-3)Sequence no.Length (bps)

β-ActinForward: GAGAAATTGTGCGTGACATCANM205518.1152 bp
Reverse: CCTGAACCTCTCATTGCCA

IRForward: GACTCTCCAACGAACAGGTGXM001233398.4156 bp
Reverse: TCAGCATCTCAATGACCTCAA

IRS-1Forward: CAAGTTTGGACAGTGGAGCGTXM003641084.3106 bp
Reverse: CAATGGTTTCCATGGCAATG

PI3KForward: CGGATGTTGCCTTACGGTTGTNM001004410.1162 bp
Reverse: GTTCTTGTCCTTGAGCCACTGAT

PKBForward: CTGATGATGCCAAGGAGATTNM205055.1175 bp
Reverse: TGGTCAGGAGGAGTGATTGT

GSK-3βForward: AGCTGTTCCGGAGTTTAGCCTATXM004938179.2151 bp
Reverse: ACGTTAGGTTCTCCACGAACCA

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.